blob_id stringlengths 40 40 | directory_id stringlengths 40 40 | path stringlengths 3 288 | content_id stringlengths 40 40 | detected_licenses listlengths 0 112 | license_type stringclasses 2
values | repo_name stringlengths 5 115 | snapshot_id stringlengths 40 40 | revision_id stringlengths 40 40 | branch_name stringclasses 684
values | visit_date timestamp[us]date 2015-08-06 10:31:46 2023-09-06 10:44:38 | revision_date timestamp[us]date 1970-01-01 02:38:32 2037-05-03 13:00:00 | committer_date timestamp[us]date 1970-01-01 02:38:32 2023-09-06 01:08:06 | github_id int64 4.92k 681M ⌀ | star_events_count int64 0 209k | fork_events_count int64 0 110k | gha_license_id stringclasses 22
values | gha_event_created_at timestamp[us]date 2012-06-04 01:52:49 2023-09-14 21:59:50 ⌀ | gha_created_at timestamp[us]date 2008-05-22 07:58:19 2023-08-21 12:35:19 ⌀ | gha_language stringclasses 147
values | src_encoding stringclasses 25
values | language stringclasses 1
value | is_vendor bool 2
classes | is_generated bool 2
classes | length_bytes int64 128 12.7k | extension stringclasses 142
values | content stringlengths 128 8.19k | authors listlengths 1 1 | author_id stringlengths 1 132 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
97d15d6f45852f8ad8f5576eff06fea5cb1089b3 | 43cbef9a8b7424fb7144255d1d9494be828e3b4c | /nes_randomizer/registration/urls.py | a6c54bd79ab683e6b46d4559d9fdcb440476523a | [] | no_license | thebmo/NESRandomizer | 59135814c3dd23d948af1f5ce7ca236c8f96dc56 | 1bad8c3ba8ed2a513f3ecd7005023f063fc3ba1f | refs/heads/master | 2020-07-05T08:19:02.916233 | 2015-11-03T03:34:32 | 2015-11-03T03:34:32 | 22,393,483 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 147 | py | from django.conf.urls import patterns, url
from . import views
urlpatterns = patterns('',
url(r'^$', views.register, name='register'),
)
| [
"bmosier@gmail.com"
] | bmosier@gmail.com |
46605773042e4694045207282c63666f3ac7d88a | b5550fc728b23cb5890fd58ccc5e1668548dc4e3 | /network/security_group/openstack_driver.py | 9717ba421b4a63ea98d5328cfd53bec9b7f01766 | [] | no_license | bopopescu/nova-24 | 0de13f078cf7a2b845cf01e613aaca2d3ae6104c | 3247a7199932abf9718fb3260db23e9e40013731 | refs/heads/master | 2022-11-20T00:48:53.224075 | 2016-12-22T09:09:57 | 2016-12-22T09:09:57 | 282,140,423 | 0 | 0 | null | 2020-07-24T06:24:14 | 2020-07-24T06:24:13 | null | UTF-8 | Python | false | false | 1,631 | py | #coding:utf-8
# Copyright 2013 Nicira, Inc.
# All Rights Reserved
#
# Licensed under the Apache License, Version 2.0 (the "License"); you may
# not use this file except in compliance with the License. You may obtain
# a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless... | [
"719184289@qq.com"
] | 719184289@qq.com |
0d8cf3d920dc76f0c4b05c2d553f6846e4799bcb | edc80b253c0ad88a421f7cd341d695e601fde73d | /utils.py | 1194f99c9f18970a5625febf931cca1ec72e84ff | [
"MIT"
] | permissive | prashantramangupta/snet-platform-usage | 62cc4061326e89ca39c1b3105362fc4b4fb9509c | 41b0669ebebf116012f312a333d0b3cbcdcf8519 | refs/heads/master | 2022-11-04T23:57:35.611828 | 2022-10-13T05:03:05 | 2022-10-13T05:03:05 | 177,531,350 | 1 | 1 | MIT | 2022-10-12T10:20:37 | 2019-03-25T06:56:31 | Python | UTF-8 | Python | false | false | 1,607 | py | import json
import datetime
import decimal
import requests
from constant import SLACK_HOOK
IGNORED_LIST = ['row_id', 'row_created', 'row_updated']
class Utils:
def __init__(self):
self.msg_type = {
0 : 'info:: ',
1 : 'err:: '
}
def report_slack(self, type, slack_msg):
... | [
"you@example.com"
] | you@example.com |
50d7896ca2a3fd81c7a3a5b423c105fc094df359 | 0f2112a0e198cb0275c002826854c836bbfb5bdf | /pywicta/image/__init__.py | ebc8b9794d95d617edc05784841fc62efa089799 | [
"MIT"
] | permissive | jeremiedecock/pywi-cta | a7f98ae59beb1adecb25623153c13e5bc70e5560 | 1185f7dfa48d60116472c12ffc423be78a250fc9 | refs/heads/master | 2021-04-15T12:06:03.723786 | 2019-03-21T02:33:15 | 2019-03-21T02:33:15 | 126,397,380 | 0 | 1 | MIT | 2018-10-16T12:17:52 | 2018-03-22T21:31:45 | Python | UTF-8 | Python | false | false | 158 | py | """Image functions
This package contains additional image processing functions.
"""
from . import hillas_parameters
from . import signal_to_border_distance
| [
"jd.jdhp@gmail.com"
] | jd.jdhp@gmail.com |
936ac1a26cc0f0c3c4098e4dab5068c152183601 | 786de89be635eb21295070a6a3452f3a7fe6712c | /root/tags/V00-03-00/SConscript | 79a8398cab91d01f66746f757727ba8c866b37e9 | [] | no_license | connectthefuture/psdmrepo | 85267cfe8d54564f99e17035efe931077c8f7a37 | f32870a987a7493e7bf0f0a5c1712a5a030ef199 | refs/heads/master | 2021-01-13T03:26:35.494026 | 2015-09-03T22:22:11 | 2015-09-03T22:22:11 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,056 | #--------------------------------------------------------------------------
# File and Version Information:
# $Id$
#
# Description:
# SConscript file for package root
#------------------------------------------------------------------------
# Do not delete following line, it must be present in
# SConscript file for... | [
"gapon@SLAC.STANFORD.EDU@b967ad99-d558-0410-b138-e0f6c56caec7"
] | gapon@SLAC.STANFORD.EDU@b967ad99-d558-0410-b138-e0f6c56caec7 | |
47aedceb25e986a3e5d3aae64be46cd960624d18 | 81f128c1d3ffc57ea35053a0f42bc3adb8ac820d | /MxShop/db_tools/import_goods_data.py | 71e3cfa1b711929ae1f857f0ba8333e70073b35b | [] | no_license | tminlun/tminlun-MxShop | f06816b5f596cffb7fa634891a70567055de1bf9 | a1ccf4b05edd8b47ad716fe65072b5be6e501e50 | refs/heads/master | 2022-12-10T11:08:28.043339 | 2019-04-15T15:12:44 | 2019-04-15T15:12:44 | 176,200,320 | 0 | 0 | null | 2022-12-08T01:43:02 | 2019-03-18T03:47:29 | Python | UTF-8 | Python | false | false | 2,099 | py | # _*_ encoding:utf-8 _*_
__author__: '田敏伦'
__date__: '2019/2/27 0027 20:38'
# 导入goods的数据
import sys
import os
pwd = os.path.dirname(os.path.realpath(__file__))
sys.path.append(pwd + "../")
os.environ.setdefault('DJANGO_SETTINGS_MODULE', 'MxShop.settings')
import django
django.setup()
from db_tools.data.product_da... | [
"you@example.com"
] | you@example.com |
150031906408644576efe4932f757a1e0abf4fa8 | ddddaa700e4642f46a2c1e1e0271a7c8ea62ba0f | /harness/determined/cli/sso.py | 026b6b502e98d88856d356e481ab9bf2cf8167e6 | [
"Apache-2.0"
] | permissive | determined-ai/determined | 9d563cb5ffd074c88ee5edc9bf22ab9c3cb78c7e | 8239b1993f4f44390f4e88901ffaf3b12429b83c | refs/heads/main | 2023-08-21T12:13:36.651298 | 2023-08-21T08:34:16 | 2023-08-21T08:34:16 | 253,846,879 | 2,531 | 330 | Apache-2.0 | 2023-09-14T21:54:17 | 2020-04-07T16:12:29 | Go | UTF-8 | Python | false | false | 5,240 | py | import sys
import webbrowser
from argparse import Namespace
from getpass import getpass
from http.server import BaseHTTPRequestHandler, HTTPServer
from typing import Any, Callable, List
from urllib.parse import parse_qs, urlparse
from determined.common import api
from determined.common.api import authentication
from d... | [
"noreply@github.com"
] | determined-ai.noreply@github.com |
01f149a939d7ee4687c0ce58037ed05278e16865 | 04142fdda9b3fb29fb7456d5bc3e504985f24cbe | /mmcv/cnn/bricks/upsample.py | 78fb5bf371712d13a72edf5d57151dca8fce6953 | [
"Apache-2.0"
] | permissive | open-mmlab/mmcv | 419e301bbc1d7d45331d67eccfd673f290a796d5 | 6e9ee26718b22961d5c34caca4108413b1b7b3af | refs/heads/main | 2023-08-31T07:08:27.223321 | 2023-08-28T09:02:10 | 2023-08-28T09:02:10 | 145,670,155 | 5,319 | 1,900 | Apache-2.0 | 2023-09-14T02:37:16 | 2018-08-22T07:05:26 | Python | UTF-8 | Python | false | false | 3,299 | py | # Copyright (c) OpenMMLab. All rights reserved.
import inspect
from typing import Dict
import torch
import torch.nn as nn
import torch.nn.functional as F
from mmengine.model import xavier_init
from mmengine.registry import MODELS
MODELS.register_module('nearest', module=nn.Upsample)
MODELS.register_module('bilinear',... | [
"noreply@github.com"
] | open-mmlab.noreply@github.com |
697a14ba16fec12bc6822c838c5c9307b462870a | 4d7f743f871860e64f7e1e057b32c8af76fe98ff | /nmtlab/utils/vocab.py | 893b2a2fcfcb1d9146383a199150e541bf465ee5 | [
"MIT"
] | permissive | MarkWuNLP/nmtlab | 8a822c7d2385f885509b9b3e5d039b8fc38562ad | da9c28126336528fc6b85f2d424632ad227a3682 | refs/heads/master | 2022-02-21T14:05:10.523962 | 2019-10-05T08:32:21 | 2019-10-05T08:32:21 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 3,111 | py | #!/usr/bin/env python
# -*- coding: utf-8 -*-
from __future__ import absolute_import
from __future__ import division
from __future__ import print_function
import torchtext.vocab
import pickle
from collections import Counter, defaultdict
DEFAULT_SPECIAL_TOKENS = ["<null>", "<s>", "</s>", "UNK"]
class Vocab(torchtex... | [
"raphael@uaca.com"
] | raphael@uaca.com |
0ff47b51128d4c3f179c4ff101481282d1461151 | 47fabc7be3769cb1d2d17369efe2048818158477 | /test/test_multinomial_splitting.py | fb9f8105646ef967184adf4470dbd210056f4169 | [
"Apache-2.0"
] | permissive | jpeyhardi/GLM | 35ae651c4aa9771fec63b7c151858e0555a80c07 | 6f0fd763aec2a0ccdef3901b71ed990f20119510 | refs/heads/master | 2021-09-26T08:50:08.938073 | 2018-10-28T13:22:24 | 2018-10-28T13:22:24 | 125,999,551 | 0 | 0 | Apache-2.0 | 2018-03-20T10:21:13 | 2018-03-20T10:21:09 | C++ | UTF-8 | Python | false | false | 1,223 | py | from statiskit import (linalg,
core,
glm)
from statiskit.data import glm as data
import unittest
from nose.plugins.attrib import attr
import math
@attr(linux=True,
osx=True,
win=True,
level=0)
class TestMultinomialSplittingRegression(unittest.TestCase):... | [
"pfernique@gmail.com"
] | pfernique@gmail.com |
26abe393261a86288211f6bc9fd241563a9b60ce | 119a85a388fe436361530fbb47932e704d749557 | /PEAK-0.5a4dev_r2085/build/lib.macosx-10.6-x86_64-2.7/peak/util/signature.py | dbd8a3fbf7c6e8f609c9564bba8de27bd211ea3d | [
"Python-2.0"
] | permissive | chrisrgunn/cs156project | 014d5b05c6bf0e08ab8bd0dea525057d0e65b9a7 | e5414a37f9793c8b0674695b948482b559b18ea6 | refs/heads/master | 2021-01-19T14:09:49.046539 | 2017-05-24T02:10:29 | 2017-05-24T02:10:29 | 88,128,762 | 0 | 2 | null | 2017-05-04T23:49:09 | 2017-04-13T05:36:10 | Python | UTF-8 | Python | false | false | 1,270 | py | """Crude introspection of call signatures"""
import protocols; from protocols import adapt, Interface
from inspect import getargspec
from types import FunctionType, MethodType
__all__ = 'ISignature', 'getPositionalArgs'
class ISignature(Interface):
# XXX There should be a lot more here than this...
def get... | [
"chrisrgunn@gmail.com"
] | chrisrgunn@gmail.com |
4cf2a8b84c3cdd0ebae529ac5397255b44f2e9ee | 5f2103b1083b088aed3f3be145d01a770465c762 | /406. Queue Reconstruction by Height.py | 54dbb0fb8a1dbe5530f49b27d210c81d690d7a0e | [] | no_license | supersj/LeetCode | 5605c9bcb5ddcaa83625de2ad9e06c3485220019 | 690adf05774a1c500d6c9160223dab7bcc38ccc1 | refs/heads/master | 2021-01-17T17:23:39.585738 | 2017-02-27T15:08:42 | 2017-02-27T15:08:42 | 65,526,089 | 2 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,520 | py | from operator import itemgetter
# todo insert order thinking
class Solution1(object):
def reconstructQueue(self, people):
"""
:type people: List[List[int]]
:rtype: List[List[int]]
"""
people.sort(key = itemgetter(1,0))
result = []
start = 0
... | [
"ml@ml.ml"
] | ml@ml.ml |
1f330a243eabf5b8c046f3eeffcee642a856d548 | 0937646b6ce9249a8d193987f308ce398dc28bd1 | /104API/104API.py | 5ec24357b53855d4c9189223fbb28b268e8829ff | [] | no_license | barry800414/JobTitleNLP | 98622d02b25b1418f28698f7d772c8de96642032 | b379c2052447e6483d17f5db51fb918b37ac7a52 | refs/heads/master | 2021-06-08T19:36:39.044757 | 2016-10-21T03:11:10 | 2016-10-21T03:11:10 | 66,043,111 | 1 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,863 | py | #!/usr/bin/env python3
# invoke 104 API to get all 104 jobs
import sys
import requests
import json
from getCat import getL3ID
API_URL = "http://www.104.com.tw/i/apis/jobsearch.cfm"
def getJobsByCatID(catID, verbose=0):
jobs = dict()
payload = {
"cat": catID,
"role": 1,
"fmt": 8,
"... | [
"barry800414@gmail.com"
] | barry800414@gmail.com |
a3ddfd87f910aeddaeb2fdccc180e2928ab42be7 | bc441bb06b8948288f110af63feda4e798f30225 | /object_store_sdk/model/notify/subscriber_pb2.py | 692c20775b418cfdc51ab0f6e6720297f4eb1271 | [
"Apache-2.0"
] | permissive | easyopsapis/easyops-api-python | 23204f8846a332c30f5f3ff627bf220940137b6b | adf6e3bad33fa6266b5fa0a449dd4ac42f8447d0 | refs/heads/master | 2020-06-26T23:38:27.308803 | 2020-06-16T07:25:41 | 2020-06-16T07:25:41 | 199,773,131 | 5 | 0 | null | null | null | null | UTF-8 | Python | false | true | 5,376 | py | # -*- coding: utf-8 -*-
# Generated by the protocol buffer compiler. DO NOT EDIT!
# source: subscriber.proto
import sys
_b=sys.version_info[0]<3 and (lambda x:x) or (lambda x:x.encode('latin1'))
from google.protobuf import descriptor as _descriptor
from google.protobuf import message as _message
from google.protobuf ... | [
"service@easyops.cn"
] | service@easyops.cn |
1b33a0d2e211750824ab74b353f3eec8b0a32f06 | 6e2dfbf50c1def19cd6ae8e536a2ddb954a5ad63 | /predict.py | 3e96f112a8763f74066d46caa470404c48356c44 | [
"BSD-3-Clause",
"LGPL-2.1-or-later",
"MIT",
"GPL-3.0-only",
"Apache-2.0"
] | permissive | boshining/NeuronBlocks | 9d71f087772eb17c3a4130d0374818cfd80d976f | 74fbb8658fb3f1cffea5c9bc84b2a1da59c20dd9 | refs/heads/master | 2020-05-27T16:24:10.244042 | 2019-08-06T07:37:55 | 2019-08-06T07:37:55 | 188,699,703 | 0 | 0 | MIT | 2019-08-06T08:19:55 | 2019-05-26T15:23:06 | Python | UTF-8 | Python | false | false | 3,096 | py | # Copyright (c) Microsoft Corporation. All rights reserved.
# Licensed under the MIT license.
from settings import ProblemTypes, version
import os
import argparse
import logging
from ModelConf import ModelConf
from problem import Problem
from LearningMachine import LearningMachine
def main(params):
conf = Mode... | [
"shoulinjun@126.com"
] | shoulinjun@126.com |
c6ddac9e303b762b38d565c374ec231de78f1052 | aac63f0f178945e8109f74ebb9bbb59165185172 | /news/urls.py | e0d7f3b27f0854cb4fa0912eb93b73f36dddd8c4 | [] | no_license | okumujustine/hacker-news-clone | 587f7e88f53d576ee58e5dfff78f4d18e046b4db | 7f70d18325c7627237de719e04bdde9ad75a8d5d | refs/heads/main | 2023-01-02T13:41:37.825072 | 2020-11-04T14:52:41 | 2020-11-04T14:52:41 | 310,032,396 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 810 | py |
from django.contrib import admin
from django.urls import path, include
from django.contrib.auth import views
from apps.core.views import signup
from apps.story.views import frontpage, search, submit, newest, vote, story
urlpatterns = [
path('', frontpage, name='frontpage'),
path('s/<int:story_id>/vote/', vot... | [
"okumujustine01@gmail.com"
] | okumujustine01@gmail.com |
fc6b3d226bbf27414b9873a6166718c97218c228 | 16fcf452e6165a0de5bc540c57b6e6b82d822bb1 | /Learntek_code/4_June_18/while2.py | 7a9891325874d47ce4779e35a821980c21e374a2 | [] | no_license | mohitraj/mohitcs | e794e9ad2eb536e3b8e385fb8d222e8ade95c802 | d6399b2acf69f5667c74f69715a0b55060bf19d1 | refs/heads/master | 2021-09-09T00:21:23.099224 | 2021-09-07T16:39:07 | 2021-09-07T16:39:07 | 87,798,669 | 5 | 6 | null | null | null | null | UTF-8 | Python | false | false | 356 | py | import getpass
print "Hello World "
print "Please enter the password\t"
pass1 = getpass.getpass()
flag1 =0
num =0
while True:
if pass1=="India":
print "Welcome in India"
break
else :
print "Wrong password type again"
num = num+1
print num
if num==3:
break
print "Please enter the password ... | [
"mohitraj.cs@gmail.com"
] | mohitraj.cs@gmail.com |
525379ed03b39dc09421131f1b21c85a278b744d | ab1f25e6266a71ea23f1d3e04ec8635ae550d1df | /HW6/Task-1/temp_HW6/person.py | 9dc7cb45a9f296a612d9c858867a544884bb3914 | [] | no_license | Pavlenkovv/e-commerce | 5143d897cf779007181a7a7b85a41acf3dfc02c4 | 0d04d7dfe3353716db4d9c2ac55b0c9ba54daf47 | refs/heads/master | 2023-01-25T03:13:41.238258 | 2020-12-06T22:16:53 | 2020-12-06T22:16:53 | 313,103,199 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 293 | py | class Person:
"""Any Person"""
def __init__(self, surname=None, name=None, age=None, *args, **kwargs):
self.surname = surname
self.name = name
self.age = age
def __str__(self):
return f'Surname: {self.surname}, name: {self.name}, age: {self.age}'
| [
"pavlenko.vyacheslav@gmail.com"
] | pavlenko.vyacheslav@gmail.com |
1dee9eaec67b0c0952431a177322b33833f669d8 | 2e682fd72e3feaa70e3f7bf2a3b83c50d783ec02 | /PyTorch/contrib/cv/detection/GCNet/dependency/mmdet/models/detectors/point_rend.py | e9d1d4b639d2027b566b58ab2b44017d39b48e54 | [
"Apache-2.0",
"BSD-2-Clause",
"MIT",
"BSD-3-Clause",
"LicenseRef-scancode-generic-cla",
"LicenseRef-scancode-unknown-license-reference",
"GPL-1.0-or-later"
] | permissive | Ascend/ModelZoo-PyTorch | 4c89414b9e2582cef9926d4670108a090c839d2d | 92acc188d3a0f634de58463b6676e70df83ef808 | refs/heads/master | 2023-07-19T12:40:00.512853 | 2023-07-17T02:48:18 | 2023-07-17T02:48:18 | 483,502,469 | 23 | 6 | Apache-2.0 | 2022-10-15T09:29:12 | 2022-04-20T04:11:18 | Python | UTF-8 | Python | false | false | 1,366 | py | # Copyright 2021 Huawei Technologies Co., Ltd
#
# Licensed under the Apache License, Version 2.0 (the License);
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed ... | [
"wangjiangben@huawei.com"
] | wangjiangben@huawei.com |
1f67fe7255fb1282c3fcc2652a59677474c9bda8 | 784936ad8234b5c3c20311ce499551ee02a08879 | /lab4/patterns/pattern04.py | 3fcf0f3989546c699ae05960faf3d52c1bb8cec2 | [] | no_license | jonlin97/CPE101 | 100ba6e5030364d4045f37e317aa05fd6a06cb08 | 985d64497a9861f59ab7473322b9089bfa57fd10 | refs/heads/master | 2021-06-16T01:31:31.025153 | 2017-02-28T19:29:11 | 2017-02-28T19:29:11 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 185 | py | import driver
def letter(row, col):
if row in [2,3,4] and col in [3,4,5,6]:
return 'M'
else:
return 'S'
if __name__ == '__main__':
driver.comparePatterns(letter)
| [
"eitan.simler@gmail.com"
] | eitan.simler@gmail.com |
1ca12f40b6da6c54896751b8fdc0c2ed2ce7ded5 | d2fb1de19bb55e3b03db94b4fdce396fe56a223e | /caesure/ecdsa_secp256k1.py | a24f78a2d48632ae1799cf42702c8927e03412a2 | [
"BSD-3-Clause",
"BSD-2-Clause"
] | permissive | mikegogulski/caesure | 83a2a0a5d9b7c16339d54076bc54d351dbe0c3e4 | ccee420665e3fb4e7a005241efc6832ead4b90d8 | refs/heads/master | 2021-01-22T00:02:40.058902 | 2014-11-04T05:54:25 | 2014-11-04T05:54:25 | 26,273,215 | 0 | 1 | null | null | null | null | UTF-8 | Python | false | false | 292 | py | # -*- Mode: Python -*-
import caesure.secp256k1
from bitcoin import dhash
class KEY:
def __init__ (self):
self.p = None
def set_pubkey (self, key):
self.p = key
def verify (self, data, sig):
return caesure.secp256k1.verify (self.p, dhash (data), sig)
| [
"gitsam@rushing.nightmare.com"
] | gitsam@rushing.nightmare.com |
d99ff535dc1910cb9019d6f11a9939d50cc55669 | acb7228022a36218846bc3f431e7a45057bb581d | /mappingpedia/migrations/0003_auto_20180214_1501.py | 9c5d9d620a594b0c3db4110b7ac1bfa980b4358a | [
"Apache-2.0"
] | permissive | oeg-upm/mappingpedia-userinterface | c6ba106f3072a4d37c1c34573e2d72882429dd1b | 1738b32f704bbf66f1ed8b78c99c71d49b208d43 | refs/heads/master | 2021-11-03T14:34:39.044575 | 2019-04-26T07:02:11 | 2019-04-26T07:02:11 | 111,107,643 | 3 | 1 | Apache-2.0 | 2018-02-28T11:55:04 | 2017-11-17T13:40:44 | HTML | UTF-8 | Python | false | false | 692 | py | # -*- coding: utf-8 -*-
# Generated by Django 1.11.7 on 2018-02-14 15:01
from __future__ import unicode_literals
import datetime
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('mappingpedia', '0002_auto_20180214_1409'),
]
operations = [
... | [
"ahmad88me@gmail.com"
] | ahmad88me@gmail.com |
f1da8b2e8cd2b49b4089ef7c8d1561bd7405bb9c | de24f83a5e3768a2638ebcf13cbe717e75740168 | /moodledata/vpl_data/380/usersdata/348/85739/submittedfiles/testes.py | 6041d85fcddfaab01edb49cb3b652c18ffee68af | [] | no_license | rafaelperazzo/programacao-web | 95643423a35c44613b0f64bed05bd34780fe2436 | 170dd5440afb9ee68a973f3de13a99aa4c735d79 | refs/heads/master | 2021-01-12T14:06:25.773146 | 2017-12-22T16:05:45 | 2017-12-22T16:05:45 | 69,566,344 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 148 | py | b = 0
a = 100
for i in range(0,a,1):
if (a%(i+1)) !=0:
b = b + 1
print(b)
| [
"rafael.mota@ufca.edu.br"
] | rafael.mota@ufca.edu.br |
ea35143cdc0111cd7637ce9c09e8694f82c80c7d | 3d91c09bca4e68bf7a527cb40ed70ac208495b93 | /library/migrations/0004_auto_20201128_0844.py | faa172d3cb83cc52c23cfb2b00723338c7b633e8 | [] | no_license | Kaik-a/OCR-Projet13 | 02e9d8c9228d6d7a09013b4ab2570304c01dfc28 | ac339002279397f43316e33a869cce797b5d92b2 | refs/heads/main | 2023-02-17T09:39:11.184120 | 2021-01-11T15:50:58 | 2021-01-11T15:50:58 | 311,875,691 | 0 | 0 | null | 2021-01-11T15:50:59 | 2020-11-11T05:51:34 | CSS | UTF-8 | Python | false | false | 368 | py | # Generated by Django 3.1.3 on 2020-11-28 08:44
from django.db import migrations
class Migration(migrations.Migration):
dependencies = [
("library", "0003_auto_20201128_0823"),
]
operations = [
migrations.AlterUniqueTogether(
name="lendedgame",
unique_together={(... | [
"mehdi.bichari@outscale.com"
] | mehdi.bichari@outscale.com |
7f271a553860b8386270632196e05e93106e5631 | 5cbf6cf8a9eb958391c371c6181c49155533b6ba | /leetcode_链表_18.排序链表(快排+归并).py | 4825959173e4f80a6369e29f6246967d3a75fdf9 | [] | no_license | cmychina/Leetcode | dec17e6e5eb25fad138a24deba1d2f087db416f7 | 18e6ac79573b3f535ca5e3eaa477eac0e60bf510 | refs/heads/master | 2022-12-20T16:09:46.709808 | 2020-09-28T04:04:54 | 2020-09-28T04:04:54 | 282,446,932 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 2,223 | py | """
链表的快排与归并排序
"""
from linklist import *
class Solution:
def sortList(self, head: ListNode) -> ListNode:
"""
归并排序，要找中点，链表中点用快慢指针
:param head:
:return:
"""
if not head or not head.next:
return head
slow,fast=head,head
while fast.next and fa... | [
"noreply@github.com"
] | cmychina.noreply@github.com |
e71f2ad4ff01abe55a1af73d50b4b2075d281736 | b2f3b7b3be11a63d5d1ddfea945439402394efe7 | /routers/stock_dividends.py | 867f17a070eb93246f322a74b193cce05c8808cc | [] | no_license | leonardoo/fast_api_stock_bvc | a8a57b9e2e3822c84829a91702ba2ce73c6ff439 | c91b9267360ed0aacd2e98a1da9b1e3b160dc837 | refs/heads/main | 2023-08-13T08:05:41.064300 | 2021-10-08T00:05:14 | 2021-10-08T00:05:14 | 383,130,473 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 2,012 | py | from typing import List
from datetime import datetime
from fastapi import APIRouter, Depends
from starlette.responses import JSONResponse
from models.stock import Stock
from models.stock_dividends import StockDividends
from models.users import User
from plugins.fastapi_users import fastapi_users
router = APIRouter(
... | [
"leonardoorozcop@gmail.com"
] | leonardoorozcop@gmail.com |
30afc63d7c5839fede97f2925e6bbb6f93e81b28 | e65453aecb1b64f75a4a6eee7ca1328984773d5d | /Test/test1.py | 662d8a12291d456ee624881943ae9a53dc213b46 | [] | no_license | huyendtt58/raSAT | 1a9a0a1c05b81877416e82c9c102ae92c6d80931 | b4f7c8995eef71bd099046c761ea19ea904fd18d | refs/heads/master | 2021-01-19T14:27:24.036231 | 2017-02-23T12:36:52 | 2017-02-23T12:36:52 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 5,520 | py | import fnmatch
import os
import subprocess
import csv
matches = []
def run(directory, initLowerBound, initUpperBound, initSbox, timeout, resultFile):
lowerBound = initLowerBound
upperBound = initUpperBound
#sbox = initSbox
solvedProblems = 0
with open(os.path.join(directory, resultFile), 'wb') as csvfile:
... | [
"toilatung90@gmail.com"
] | toilatung90@gmail.com |
95292dbab6b727fc93cbd5ed860178fecee84ca4 | 752116ef4b69a3049fef0cfe9b3d212548cc81b1 | /sources/actions/watch/describe.py | ef16f46eb7e4fe787faa620233f6f13455fd54fb | [] | no_license | VDOMBoxGroup/runtime2.0 | e54af4af7a642f34b0e07b5d4096320494fb9ae8 | cb9932f5f75d5c6d7889f26d58aee079b4127299 | refs/heads/develop | 2023-07-07T11:06:10.817093 | 2023-07-03T06:11:55 | 2023-07-03T06:11:55 | 62,622,255 | 0 | 12 | null | 2023-05-23T02:55:00 | 2016-07-05T09:09:48 | Python | UTF-8 | Python | false | false | 4,418 | py |
from logs import console
from utils.structure import Structure
from utils.parsing import VALUE, Parser, ParsingException
from ..auxiliary import section, show
from .auxiliary import query
REQUEST = "<action name=\"describe\">%s</action>"
SOURCE_OBJECTS_OPTION = "<option name=\"source\">objects</option>"
SOURCE_GARBA... | [
"nikolay.grishkov@vdombox.ru"
] | nikolay.grishkov@vdombox.ru |
87cee6b3fc7d259b87a0cb05ee0fee88ed14e10f | 9ae2d337cbfa56768580187cc507f9c3c4ace1a8 | /test/test_meshzoo.py | abc4f1e9a37a6ea0c9ac22e5aea80e860fa44c3f | [
"MIT"
] | permissive | tongluocq/meshzoo | 5a734012e02f70bdf37147a3520b733f5095da02 | 46d3a999b7537fdcea92cd19ae53920b8639b0b3 | refs/heads/master | 2020-09-26T11:21:16.086387 | 2019-10-16T16:36:25 | 2019-10-16T16:36:25 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 7,706 | py | import numpy
import pytest
import meshzoo
from helpers import _near_equal
def test_cube():
points, cells = meshzoo.cube()
assert len(points) == 1331
assert len(cells) == 5000
points, cells = meshzoo.cube(nx=3, ny=3, nz=3)
assert len(points) == 27
assert all(numpy.sum(points, axis=0) == [13.5... | [
"nico.schloemer@gmail.com"
] | nico.schloemer@gmail.com |
586fbbda387bcc0fd0af65aec9272afaf55c6d94 | db3a0578ef5d79cee7f9e96fa3fd291bbaaf9eb4 | /Pygame/Bees/bees.py | 90620d058d1920a15e8892180aa8c230a8c0d55f | [
"MIT"
] | permissive | otisgbangba/python-lessons | 0477a766cda6bc0e2671e4cce2f95bc62c8d3c43 | a29f5383b56b21e6b0bc21aa9acaec40ed4df3cc | refs/heads/master | 2022-11-03T22:10:52.845204 | 2020-06-13T15:42:40 | 2020-06-13T15:42:40 | 261,255,751 | 1 | 0 | MIT | 2020-05-04T17:48:12 | 2020-05-04T17:48:11 | null | UTF-8 | Python | false | false | 1,885 | py | import pygame, random
from pygame.locals import *
from util import loadImage
from bee import Bee
from flower import Flower
from score import Score
pygame.init()
TITLE = 'Bee, Get the Nectar!'
screen = pygame.display.set_mode((1280, 720), 0)
screenRect = screen.get_rect()
Bee.loadImages()
Flower.loadImages()
background... | [
"daveb@davebsoft.com"
] | daveb@davebsoft.com |
fc5c6cf54acdc92357aedf5a77af4161c7885cb0 | 44064ed79f173ddca96174913910c1610992b7cb | /Second_Processing_app/temboo/Library/Box/Users/DeleteUser.py | 19db5a19eb485a39cf7171ed247400616e188e0a | [] | no_license | dattasaurabh82/Final_thesis | 440fb5e29ebc28dd64fe59ecd87f01494ed6d4e5 | 8edaea62f5987db026adfffb6b52b59b119f6375 | refs/heads/master | 2021-01-20T22:25:48.999100 | 2014-10-14T18:58:00 | 2014-10-14T18:58:00 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 3,041 | py | # -*- coding: utf-8 -*-
###############################################################################
#
# DeleteUser
# Deletes a specified user.
#
# Python version 2.6
#
###############################################################################
from temboo.core.choreography import Choreography
from temboo.core... | [
"dattasaurabh82@gmail.com"
] | dattasaurabh82@gmail.com |
b4fdf0086dda0bb0a9e8e631adbd62959995d35f | be01d0d54723d1e876c9a15618921dffe2b2255a | /Python/BinarySearch/two_sumII.py | 0d534e7163571ad8332aad8f4b807b4999e276c6 | [] | no_license | jxlxt/leetcode | 17e7f25bf94dd334ac0d6254ffcffa003ed04c10 | a6e6e5be3dd5f9501d0aa4caa6744621ab887f51 | refs/heads/master | 2023-05-26T22:10:03.997428 | 2023-05-24T02:36:05 | 2023-05-24T02:36:05 | 118,216,055 | 0 | 0 | null | 2018-01-20T06:31:57 | 2018-01-20T06:30:06 | null | UTF-8 | Python | false | false | 1,122 | py | #! /Users/xiaotongli/anaconda3/bin/python
# -*- coding: utf-8 -*-
# @Time : 9/28/18 10:57 PM
# @Author : Xiaotong Li
# @School : University of California, Santa Cruz
# @FileName: autocomplete_System.py
# @Software: PyCharm
class Solution:
def twoSum(self, numbers, target):
"""
:type numbers: L... | [
"xli239@ucsc.edu"
] | xli239@ucsc.edu |
5bc08a32ba5bc9e78823dc89fe5070e1deb89e25 | 057d2d1e2a78fc89851154e87b0b229e1e1f003b | /venv/Lib/site-packages/keystoneclient/auth/identity/v2.py | add1da4f5d894be3192f1253735eca8da6d07f56 | [
"Apache-2.0"
] | permissive | prasoon-uta/IBM-Cloud-Secure-File-Storage | 276dcbd143bd50b71121a73bc01c8e04fe3f76b0 | 82a6876316715efbd0b492d0d467dde0ab26a56b | refs/heads/master | 2022-12-13T00:03:31.363281 | 2018-02-22T02:24:11 | 2018-02-22T02:24:11 | 122,420,622 | 0 | 2 | Apache-2.0 | 2022-12-08T05:15:19 | 2018-02-22T02:26:48 | Python | UTF-8 | Python | false | false | 7,824 | py | # Licensed under the Apache License, Version 2.0 (the "License"); you may
# not use this file except in compliance with the License. You may obtain
# a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under t... | [
"prasoon1812@gmail.com"
] | prasoon1812@gmail.com |
319a8ecd8143da437cd5720b73ed24a1a396c1cc | 2f09e893c3a21f4a17c95b99446d1efbf0b109f7 | /huaytools/tensorflow/layers/__init__.py | 6f45582415c893a8cb74a1d2dd931b0b6805be10 | [
"MIT"
] | permissive | knight134/huaytools | b19f0078e724963415c63d60218ae3cc624f598a | cbecd6771c05f8241e756a7619047589397b16d3 | refs/heads/master | 2020-04-24T18:30:27.732740 | 2018-05-27T13:51:24 | 2018-05-27T13:51:24 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,595 | py | """
"""
import tensorflow as tf
import tensorlayer as tl
# from .cnn import *
# from .rnn import *
from .attention import *
from .embedding import *
logging = tf.logging
def dense(inputs, n_units,
activation=tf.nn.relu,
use_bias=True,
W_init=tf.truncated_normal_initializer(stddev=0.1)... | [
"imhuay@163.com"
] | imhuay@163.com |
df84bf9d01fc1b6084257e37167497a0c70e75dd | a5a99f646e371b45974a6fb6ccc06b0a674818f2 | /Configuration/Generator/python/SingleElectronFlatPt5To100_pythia8_cfi.py | 37df2ba0d8904688e35cfd867a38350252f6e5ef | [
"Apache-2.0"
] | permissive | cms-sw/cmssw | 4ecd2c1105d59c66d385551230542c6615b9ab58 | 19c178740257eb48367778593da55dcad08b7a4f | refs/heads/master | 2023-08-23T21:57:42.491143 | 2023-08-22T20:22:40 | 2023-08-22T20:22:40 | 10,969,551 | 1,006 | 3,696 | Apache-2.0 | 2023-09-14T19:14:28 | 2013-06-26T14:09:07 | C++ | UTF-8 | Python | false | false | 813 | py | import FWCore.ParameterSet.Config as cms
generator = cms.EDFilter("Pythia8PtGun",
PGunParameters = cms.PSet(
MaxPt = cms.double(5.),
MinPt = cms.double(100.),
ParticleID = cms.vint32(11),
AddAntiParticle = cms.bool(True),
MaxEta = cms.double(2.5),
... | [
"you@somedomain.com"
] | you@somedomain.com |
7c258ecc296b93e65bf8e0cbc5b9c3df0c21f607 | 21818228cb62d31b9685de44deb27cfd90430573 | /ccxt/flowbtc.py | 2153a8b8e285212a60a2754aaf3d616c1ebb77d1 | [] | no_license | mico/cryptoArbitrage | d9d5d2f89e3fccc0b84d9c13b771edef0f2b00a1 | ea9ef03e79f302b36948746c77e4acbb3d6f01b7 | refs/heads/master | 2021-03-22T00:17:30.448593 | 2018-05-28T05:08:21 | 2018-05-28T05:08:21 | 108,232,310 | 2 | 4 | null | null | null | null | UTF-8 | Python | false | false | 7,310 | py | # -*- coding: utf-8 -*-
from ccxt.base.exchange import Exchange
from ccxt.base.errors import ExchangeError
class flowbtc (Exchange):
def describe(self):
return self.deep_extend(super(flowbtc, self).describe(), {
'id': 'flowbtc',
'name': 'flowBTC',
'countries': 'BR', ... | [
"artur.komarov@gmail.com"
] | artur.komarov@gmail.com |
dcd8e325ace6b51794580b2b65cb39022b4d9256 | 837ebd601d0882e370522719606c975b9c815ad2 | /adm/templates/plugins/mediation/{{cookiecutter.name}}/main/application.py | 9ee876166f3b2151ae78f6033bb9438e0b514679 | [
"BSD-3-Clause"
] | permissive | dearith/mfserv | 8ba97e211d31a177fc6de160cd4b1f8555ebf600 | ad72e51bf77595a75dcb2600d7323f13e2c2fb4b | refs/heads/master | 2021-08-15T21:17:30.528351 | 2019-04-25T10:25:58 | 2019-04-25T10:25:58 | 183,577,154 | 0 | 0 | null | 2019-04-26T07:10:44 | 2019-04-26T07:10:43 | null | UTF-8 | Python | false | false | 2,141 | py | from aiohttp import web, ClientSession
from aiohttp_metwork_middlewares import mflog_middleware
CHUNK_SIZE = 4096 * 1024
STREAMING_MODE = True
async def handle(request):
# Log something with context aware logger
log = request['mflog_logger']
http_method = request.method
url_path_qs = request.path_qs... | [
"fabien.marty@gmail.com"
] | fabien.marty@gmail.com |
c117af46846c1174ea7008f8552fa52b1505a9b8 | ebbfc69c9b14b8fd0e8b51abb0ba4f767abce6e9 | /sandbook/base/models/novel.py | 3e4e8fdb929f8cfbc346753c49db9354d87a73f8 | [] | no_license | lwaxx/novel | 0a882347dffaafb35f061eaf6301abe32254b54f | 5b538e85606cd22c34ac10f53438fc0d3ff131a0 | refs/heads/master | 2022-06-30T03:21:52.673001 | 2020-05-09T15:26:58 | 2020-05-09T15:26:58 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 7,965 | py | import os
import re
import time
from django.core.files.storage import FileSystemStorage
from django.db import models
from base.constants.novel import (
DEFAULT_COVER, NOVEL_STATUS_UNAPPROVED, NOVEL_STATUS_ACTIVE, NOVEL_STATUS_FINISHED,
NOVEL_STATUS_BLOCKED
)
from django.core.cache import cache
from general.u... | [
"1225191678@qq.com"
] | 1225191678@qq.com |
dcd9d496ee0141ea04f9a8c83b711f5ce5252089 | ffc1cc3bb7b68335b115122fdc7924fc4e31d528 | /pro38.py | fd23c4fc45f9509da980b95618a4cae2a5d6442b | [] | no_license | Rihanashariff/swathi24 | dba1dd3c3d2ff583ae431b432e0ef262bfeb3ac3 | 2b0d21f2febdd2a563e8f0affeebd5ca7a5821b8 | refs/heads/master | 2020-07-02T05:28:32.199982 | 2019-06-29T08:22:10 | 2019-06-29T08:22:10 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 132 | py | #s
n,k = map(int,input().split())
l = list(map(int,input().split()))
c= 0
for i in l:
if(i+k <=5):
c+=1
g=c//3
print(g)
| [
"noreply@github.com"
] | Rihanashariff.noreply@github.com |
cc09ec3dc544f923a01256d80c96928a1ec33d28 | 0dc24a6e729a4b438fbcd9cfb72da3b6ee716d77 | /ksiazka_zrob_to_sam/my_electric_car.py | 10fbec7652bb7144eb706ddd63de707e5df80507 | [] | no_license | Licho59/learning_python_eric_matthes_book | fca84a2bff207c10dec20c7fea9aeacf05d6a101 | 969f95132822d8bd21c30403d8e0bf6aadb9914f | refs/heads/master | 2021-09-01T03:41:37.281741 | 2017-12-24T15:12:13 | 2017-12-24T15:12:13 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 784 | py | # -*- coding: utf-8 -*-
"""
Created on Mon May 8 21:20:17 2017
@author: Leszek
"""
from car import ElectricCar
my_tesla = ElectricCar('tesla', 'model s', 2016)
print(my_tesla.get_descriptive_name())
my_tesla.battery.describe_battery()
my_tesla.battery.get_range()
# Import wielu klas z modułu
from car import Car,... | [
"lestlalka@gmail.com"
] | lestlalka@gmail.com |
5487773f243f788ebc92256016ebad447a41750c | d5f75adf5603927396bdecf3e4afae292143ddf9 | /python/paddle/fluid/tests/unittests/test_kthvalue_op.py | 66eb8ab4f31fba1ef8cb7eee8a8896077b683a1f | [
"Apache-2.0"
] | permissive | jiweibo/Paddle | 8faaaa1ff0beaf97ef7fb367f6c9fcc065f42fc4 | 605a2f0052e0ffb2fab3a4cf4f3bf1965aa7eb74 | refs/heads/develop | 2023-07-21T03:36:05.367977 | 2022-06-24T02:31:11 | 2022-06-24T02:31:11 | 196,316,126 | 3 | 2 | Apache-2.0 | 2023-04-04T02:42:53 | 2019-07-11T03:51:12 | Python | UTF-8 | Python | false | false | 6,945 | py | # Copyright (c) 2021 PaddlePaddle Authors. All Rights Reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by app... | [
"noreply@github.com"
] | jiweibo.noreply@github.com |
a272e1b11c4ec4f975a6dd241d020af9876ef059 | 6d8ed9e06e7783443fac3d100a4fdea304d5d64e | /dashboard/internet_nl_dashboard/migrations/0036_urllistreport_average_internet_nl_score.py | de64746ac2b34bee044538ef4f70302d905e030b | [
"Apache-2.0"
] | permissive | internetstandards/Internet.nl-dashboard | 399c6d13d66bbc56b1a5b964a727cc299d351bd8 | f1f68352a173689e2386d790f69bd28640a75e09 | refs/heads/main | 2023-08-31T21:01:42.739287 | 2023-07-12T10:51:16 | 2023-07-12T10:51:16 | 175,843,928 | 7 | 8 | Apache-2.0 | 2023-09-13T08:45:51 | 2019-03-15T15:16:49 | JavaScript | UTF-8 | Python | false | false | 667 | py | # Generated by Django 2.2.2 on 2019-06-28 07:51
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('internet_nl_dashboard', '0035_auto_20190624_0712'),
]
operations = [
migrations.AddField(
model_name='urllistreport',
... | [
"elger.jonker@gmail.com"
] | elger.jonker@gmail.com |
b363e6a7cb06107e6b57f522269db06f2372e699 | 7be4f595d555614a28f708c1ba7edda321f0cf30 | /practice/algorithms/implementation/find_digits/find_digits.py | 944aa7f96b379dc5bf1efe15f35da50bb098ef74 | [] | no_license | orel1108/hackerrank | de31a2d31aaf8aeb58477d1f2738744bfe492555 | 55da1f3a94e8c28ed0f0dea3103e51774f0047de | refs/heads/master | 2021-04-09T17:38:25.112356 | 2017-01-22T11:21:19 | 2017-01-22T11:21:19 | 50,198,159 | 3 | 0 | null | null | null | null | UTF-8 | Python | false | false | 153 | py | t = int(raw_input())
for _ in range(t) :
n = raw_input()
digits = map(int, n)
print len(filter(lambda x: x > 0 and int(n) % x == 0, digits))
| [
"r.orlovskyi@gmail.com"
] | r.orlovskyi@gmail.com |
444d45bf3c5ac155b55dfd08b8250911a948e0c8 | a550aece79bda789826b463280b91abffbf2d372 | /books/python-3-oop-packt/Chapter7/7_28_callable_repeat.py | 09746de64e095feb18df107627ebdb96c1fe1546 | [
"MIT"
] | permissive | phiratio/learn_python | 20376470eaa292c157fd01f52b3077e3a983cd5a | a32240d4355fb331805d515f96e1d009914e5c47 | refs/heads/master | 2022-11-27T07:07:45.712373 | 2020-12-03T22:04:31 | 2020-12-03T22:04:31 | 189,397,679 | 1 | 0 | MIT | 2022-11-22T04:40:27 | 2019-05-30T10:56:10 | Python | UTF-8 | Python | false | false | 469 | py | from timer import Timer
import datetime
def format_time(message, *args):
now = datetime.datetime.now().strftime("%I:%M:%S")
print(message.format(*args, now=now))
class Repeater:
def __init__(self):
self.count = 0
def __call__(self, timer):
format_time("{now}: repeat {0}", self.count)
... | [
"phiratio161@gmail.com"
] | phiratio161@gmail.com |
088099fe03d5e3dee4df77f61ea5cb2aa08d45d5 | f0d713996eb095bcdc701f3fab0a8110b8541cbb | /M8hDPzNZdie8aBMcb_11.py | f8aa226b0f1d8e00377c89c45f1f158d226792c3 | [] | no_license | daniel-reich/turbo-robot | feda6c0523bb83ab8954b6d06302bfec5b16ebdf | a7a25c63097674c0a81675eed7e6b763785f1c41 | refs/heads/main | 2023-03-26T01:55:14.210264 | 2021-03-23T16:08:01 | 2021-03-23T16:08:01 | 350,773,815 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 737 | py | """
Implement a function count_substring that counts the number of substrings that
begin with character "A" and ends with character "X".
For example, given the input string `"CAXAAYXZA"`, there are four substrings
that begin with "A" and ends with "X", namely: "AX", "AXAAYX", "AAYX", and
"AYX".
### Examples
c... | [
"daniel.reich@danielreichs-MacBook-Pro.local"
] | daniel.reich@danielreichs-MacBook-Pro.local |
5458665911175eba625d5f5b7fc0cc7853562425 | 9d82e37d34ed4d836fcef98ed37ed7ac5c49b316 | /ibmsecurity/isam/web/embedded_ldap/admin.py | a068695630ebb77e72b212d90faed1a94943d4d2 | [
"Apache-2.0"
] | permissive | keiran-ibm/ibmsecurity | 075c156961e371c0e85a7c360fb2d82954315bb6 | b1a77f7a1e8c3cce67e2c3af85c20626d42c0bbd | refs/heads/master | 2022-02-14T14:24:15.687461 | 2019-01-18T05:21:19 | 2019-01-18T05:21:19 | 116,325,033 | 0 | 0 | Apache-2.0 | 2019-01-18T05:16:46 | 2018-01-05T01:23:35 | Python | UTF-8 | Python | false | false | 643 | py | import logging
logger = logging.getLogger(__name__)
def set_pw(isamAppliance, password, check_mode=False, force=False):
"""
Changing the administrator password of the embedded LDAP server
"""
if check_mode is True:
return isamAppliance.create_return_object(changed=True)
else:
retu... | [
"rsreera@us.ibm.com"
] | rsreera@us.ibm.com |
be65e8b6843e01ce485befc48c2d14bde2967dea | 7bc54bae28eec4b735c05ac7bc40b1a8711bb381 | /src/contradiction/medical_claims/alamri/tfrecord_gen.py | 5ddfa13b77c7f7eda2cea802707861ff4e6e6373 | [] | no_license | clover3/Chair | 755efd4abbd5f3f2fb59e9b1bc6e7bc070b8d05e | a2102ebf826a58efbc479181f1ebb5de21d1e49f | refs/heads/master | 2023-07-20T17:29:42.414170 | 2023-07-18T21:12:46 | 2023-07-18T21:12:46 | 157,024,916 | 0 | 0 | null | 2023-02-16T05:20:37 | 2018-11-10T21:55:29 | Python | UTF-8 | Python | false | false | 3,932 | py | import json
import os
from typing import Iterator
from contradiction.medical_claims.alamri.pairwise_gen import enum_true_instance, enum_neg_instance, enum_neg_instance2, \
enum_neg_instance_diff_review
from contradiction.medical_claims.biobert.voca_common import get_biobert_tokenizer
from cpath import at_output_di... | [
"lesterny@gmail.com"
] | lesterny@gmail.com |
b324821f4e1cb588672bdca6d07e05ff834b9547 | a939ec03a7eb31962817d6cffea7f125ea4d69db | /DataScience/pandas/Example02_series.py | 9983ac491066a66c45841303c88fcc293db3bfb3 | [] | no_license | dipayandutta/python3 | e21e50d7a21315bc63702a103af79f3d61d91ab1 | f3d01ea52d05a23103cf86afbf5dff64a5d36634 | refs/heads/master | 2022-12-10T09:13:04.967400 | 2021-07-25T15:20:40 | 2021-07-25T15:20:40 | 153,072,927 | 0 | 0 | null | 2022-11-22T02:24:01 | 2018-10-15T07:46:28 | Python | UTF-8 | Python | false | false | 144 | py | #Manually assign index values to a series
import pandas as pd
series = pd.Series(['Dipayan','Ruby'],index=['Husband','spouse'])
print(series) | [
"inbox.dipayan@gmail.com"
] | inbox.dipayan@gmail.com |
5f956a3f925ac4a9a724e8128b079d5b8afa2c82 | 45734abde30b437c2a1ba80653d7323e5c1d8c7f | /python/0320_generalized_abbreviation.py | f56e22143bc7bf3043f75dbf895dd29533b46079 | [] | no_license | rdtr/leetcode_solutions | 6629e03dd5b5fee15aaabe7f53204778f237ed96 | 51800d33c57e36ef62b6067d6f91a82c0e55dc6d | refs/heads/main | 2022-05-21T12:17:23.201832 | 2022-03-12T09:20:46 | 2022-03-12T09:20:46 | 80,395,988 | 1 | 0 | null | null | null | null | UTF-8 | Python | false | false | 717 | py | from collections import deque
class Solution:
def generateAbbreviations(self, word: str) -> List[str]:
res = []
self.helper(word, 0, 0, '', res)
return res
def helper(self, word, pos, length, cur, res):
if pos >= len(word):
if length > 0:
cur += str... | [
"redtree.dev1112@gmail.com"
] | redtree.dev1112@gmail.com |
0991be737f49582ec10aa7eedbd0a61d6dfe7b40 | 9b0bdebe81e558d3851609687e4ccd70ad026c7f | /剑指offer/02.从尾到头打印链表.py | c171768fb4cf4ebffccff7c7bf930ebb8b0066c0 | [] | no_license | lizenghui1121/DS_algorithms | 645cdad007ccbbfa82cc5ca9e3fc7f543644ab21 | 9690efcfe70663670691de02962fb534161bfc8d | refs/heads/master | 2022-12-13T22:45:23.108838 | 2020-09-07T13:40:17 | 2020-09-07T13:40:17 | 275,062,257 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 509 | py | """
输入一个链表，按链表从尾到头的顺序返回一个ArrayList。
@Author: Li Zenghui
@Date: 2020-03-02 20:10
"""
# -*- coding:utf-8 -*-
# class ListNode:
# def __init__(self, x):
# self.val = x
# self.next = None
class Solution:
# 返回从尾部到头部的列表值序列，例如[1,2,3]
def printListFromTailToHead(self, listNode):
res = []
... | [
"954267393@qq.com"
] | 954267393@qq.com |
b08c2c670bcb0c5c3ca004b5b5e8ae7656f10ffa | 369b985626c565096a3e65635542ac708339b329 | /blog/urls.py | 9a3cbcfd3770f5beceeffc016a5790b887880504 | [
"MIT"
] | permissive | ernestmucheru/Week4-IP | 9a68b28a127d8746d777d7b67e2cc055d034980c | be80372a33cbc3e80644915db66e0bf51cced175 | refs/heads/main | 2023-06-27T19:45:48.071039 | 2021-07-27T06:34:22 | 2021-07-27T06:34:22 | 389,307,262 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 646 | py | from django.urls import path
# from .views import (PostListView,PostDetailView,PostCreateView,PostUpdateView,PostDeleteView)
from . import views
urlpatterns =[
# path('', PostListView.as_view(), name='blog'),
# path('post/<int:pk>/', PostDetailView.as_view(), name='post-detail'),
# path('post/new/', PostCr... | [
"you@example.com"
] | you@example.com |
2f9e3f9b1f607d3f89fc3e056f19fcccad2f74fe | 28a462a28f443c285ca5efec181ebe36b147c167 | /tests/compile/basic/recent/String.prototype.startsWith.spec | ba62e090c26d2ee9be97ca1a97a2010796ad2856 | [
"BSD-3-Clause",
"BSD-2-Clause"
] | permissive | kaist-plrg/jstar | 63e71f9156860dc21cccc33a9f6c638dfee448ea | 1282919127ea18a7e40c7a55e63a1ddaaf7d9db4 | refs/heads/main | 2022-07-22T08:12:34.947712 | 2022-02-27T04:19:33 | 2022-02-27T11:06:14 | 384,045,526 | 6 | 4 | NOASSERTION | 2022-02-27T11:05:26 | 2021-07-08T07:53:21 | Python | UTF-8 | Python | false | false | 884 | spec | 1. Let _O_ be ? RequireObjectCoercible(*this* value).
1. Let _S_ be ? ToString(_O_).
1. Let _isRegExp_ be ? IsRegExp(_searchString_).
1. If _isRegExp_ is *true*, throw a *TypeError* exception.
1. Let _searchStr_ be ? ToString(_searchString_).
1. Let _len_ be t... | [
"h2oche22@gmail.com"
] | h2oche22@gmail.com |
9d0b0a941398fd991247b3a0ec96412244d364c5 | 30fe7671b60825a909428a30e3793bdf16eaaf29 | /.metadata/.plugins/org.eclipse.core.resources/.history/9a/f0d15008ccf800161174a93fd5908e78 | 96f863b8b89de32901e8cf640c731bc4ebefeb38 | [] | no_license | abigdream84/PythonStudy | 0fc7a3b6b4a03a293b850d0ed12d5472483c4fb1 | 059274d3ba6f34b62ff111cda3fb263bd6ca8bcb | refs/heads/master | 2021-01-13T04:42:04.306730 | 2017-03-03T14:54:16 | 2017-03-03T14:54:16 | 79,123,274 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 983 | #!/usr/bin/env python
#coding:UTF-8
from audit_demo.utility.MySqlHelper import MySqlHelper
class g_table(object):
def __init__(self):
self.__helper = MySqlHelper()
def add_grp(self,gpname):
sql = 'insert into g_table(g_name) values(%s)'
try:
self.__helper.insert(sql,gp... | [
"abigdream@hotmail.com"
] | abigdream@hotmail.com | |
d78e9b91414cf74ab0da36fd5f6de8f911a9e0cd | 53eee7eb899cb518983008532257037fb89def13 | /2579.count-total-number-of-colored-cells.py | eb2d7d5de90aeac6f2c95bbec4eef4b247461260 | [] | no_license | chenxu0602/LeetCode | 0deb3041a66cb15e12ed4585bbe0fefce5dc6b26 | 3dc5af2bc870fcc8f2142130fcd2b7cab8733151 | refs/heads/master | 2023-07-05T19:26:21.608123 | 2023-07-02T08:35:35 | 2023-07-02T08:35:35 | 233,351,978 | 2 | 0 | null | null | null | null | UTF-8 | Python | false | false | 273 | py | #
# @lc app=leetcode id=2579 lang=python3
#
# [2579] Count Total Number of Colored Cells
#
# @lc code=start
class Solution:
def coloredCells(self, n: int) -> int:
# return n * n + (n - 1) * (n - 1)
return 2 * n * (n - 1) + 1
# @lc code=end
| [
"chenxu@MacBook-Pro.local"
] | chenxu@MacBook-Pro.local |
3c74be0064501659bed8cf392ce9d5f5ca0414a4 | bede337b5ee193bb5669c855b70a78d929dc5ae8 | /apps/one_password.py | ca9110f9a15ed7b774c7eb7f446788b5cfa0d019 | [
"0BSD"
] | permissive | dwiel/talon-user | ffe83c05e054626431fe12c14dbfe850950fa4c4 | 559617135408ea2ceafaef54564438405546f255 | refs/heads/master | 2020-09-12T22:58:36.575833 | 2019-11-19T17:12:05 | 2019-11-19T17:12:05 | 222,585,938 | 0 | 0 | NOASSERTION | 2019-11-19T02:00:20 | 2019-11-19T02:00:19 | null | UTF-8 | Python | false | false | 217 | py | from talon import ctrl
from talon.voice import Context, Key
from ..utils import text, delay
ctx = Context("1password")
ctx.keymap({
"password [<dgndictation>] [over]": [Key("shift-cmd-\\"), delay(0.2), text],
}) | [
"dwight.holman@workday.com"
] | dwight.holman@workday.com |
050f2631f6b47527fb3ebdc876e7b392d2199011 | 3ffb51fa2241cba9c9680ab01f8da4057861f849 | /collezione/migrations/0023_auto_20181102_1526.py | a6e5117963a13b170e60c828a4b8d205856cf3f5 | [] | no_license | mions1/Euros | a663d9e3a38de56c51091233e6b4fc6db3147fb2 | faa74139e178b2c9dc868a536518715bed91c676 | refs/heads/master | 2020-04-08T00:12:45.713416 | 2018-11-23T14:35:45 | 2018-11-23T14:35:45 | 158,842,175 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 755 | py | # Generated by Django 2.1.2 on 2018-11-02 15:26
from django.db import migrations, models
import django.utils.timezone
class Migration(migrations.Migration):
dependencies = [
('collezione', '0022_auto_20181030_2030'),
]
operations = [
migrations.AddField(
model_name='acquisto... | [
"simone.mione1@gmail.com"
] | simone.mione1@gmail.com |
e5fb1f72e9850b7e778c6e302a06e49f892d630d | 6c219c027c7d0ef454bdeac196bd773e8b95d602 | /system/tomcat/tomcat_put_exec.py | 5d95b87eb442bce192ffbb30043ed14ef2a86d4f | [] | no_license | aStrowxyu/pocscan | 663f3a3458140e1bce7b4dc3702c6014a4c9ac92 | 08c7e7454c6b7c601bc54c21172c4788312603b1 | refs/heads/master | 2020-04-19T10:00:56.569105 | 2019-01-29T09:31:31 | 2019-01-29T09:31:31 | 168,127,418 | 4 | 0 | null | null | null | null | UTF-8 | Python | false | false | 2,561 | py | #!/usr/bin/env python
# -*- coding: utf-8 -*-
'''
name: Tomcat代码执行漏洞(CVE-2017-12616)
referer: https://mp.weixin.qq.com/s/dgWT3Cgf1mQs-IYxeID_Mw
author: Lucifer
description: 当 Tomcat 运行在 Windows 主机上，且启用了 HTTP PUT 请求方法（例如，将 readonly 初始化参数由默认值设置为 false），攻击者将有可能可通过精心构造的攻击请求向服务器上传包含任意代码的 JSP 文件。之后，JSP 文件中的代码将能被服务器执行。
影响版本:A... | [
"wangxinyu@vackbot.com"
] | wangxinyu@vackbot.com |
e06edc9ef4206d01ba268cd77e82b51af3988588 | 00f3468d8917ac0c1b4df8b4dc50e82c0d9be3fa | /seqsfromfasta.py | f7aa0be287db92eee1959c13a03c700c3416c9e7 | [] | no_license | berkeleyphylogenomics/BPG_utilities | 4e332bb401b8c057502a1a0a1d532396bfff9542 | bbf5df137a0a459598c3f9073d80f0086e5f7550 | refs/heads/master | 2021-01-01T19:21:13.740575 | 2014-11-05T18:40:31 | 2014-11-05T18:40:31 | 24,867,074 | 1 | 0 | null | null | null | null | UTF-8 | Python | false | false | 572 | py | #!/usr/bin/env python
from Bio import SeqIO
def seqpull(h, *args): #should use 'any' in py > 2.3
return ''.join([seq.format('fasta') for seq in SeqIO.parse(h,'fasta') \
if sum([seq.id.count(arg) for arg in args])])
if __name__ == '__main__':
import sys
if len(sys.argv) < 3:
print "%s: get... | [
"afrasiabi@berkeley.edu"
] | afrasiabi@berkeley.edu |
0de765120183e963c96ef35cf7a5098d79f772b4 | 21e5825959a886787a3915ff0d3efa86d9cd3702 | /combat/finishers/impale.py | 7b32166eb2c800a2409971f38f6bb0c6ea4ef7f5 | [
"MIT"
] | permissive | ChrisLR/Python-Roguelike-Template | e0df37752907377e606197f2469fda61202129d5 | 9b63742b0111c7e9456fb98a96a3cd28d41a1e10 | refs/heads/master | 2021-06-26T07:48:39.215338 | 2017-09-14T21:46:08 | 2017-09-14T21:46:08 | 69,761,175 | 0 | 0 | null | 2017-09-14T21:46:09 | 2016-10-01T20:09:24 | Python | UTF-8 | Python | false | false | 2,188 | py | from combat.enums import DamageType
from combat.finishers.base import Finisher
from echo import functions
from util import gridhelpers
class Impale(Finisher):
name = "Impale"
description = "Impale your enemy with a slashing or piercing weapon."
attacker_message = "You impale {defender}'s {defender_bodypar... | [
"arzhul@gmail.com"
] | arzhul@gmail.com |
106b49f1d09d2c07ec615d4ff6eada48156bac0f | ed3c924c42baa3ab825a482efc15f85a32c06eaa | /boj16649.py | 471eee9a27c32f61b4009e52d88b52912bb2b19c | [] | no_license | JoinNova/baekjoon | 95e94a7ccae51103925e515d765ebda7b6fffeed | 33b900696ecf2a42b8e452fdeae6ee482143e37e | refs/heads/master | 2020-04-16T22:25:31.577968 | 2019-04-28T04:25:24 | 2019-04-28T04:25:24 | 165,966,949 | 2 | 0 | null | null | null | null | UTF-8 | Python | false | false | 469 | py | #boj16649 Building a Stair
def stair(cube):
cnt=cube
row=(cube+1)//2
print(row+1)
pic='.'*(row+1)+'\n'
for i in range(row):
for j in range(row):
if j==0 or i==row-1:
pic+='o';cnt-=1
elif cube%2==0 and i==row-2 and j==1:
pic+='o';cnt-=1;... | [
"noreply@github.com"
] | JoinNova.noreply@github.com |
65e9e8ebbf9a9682f5fb9acfd790fad23e123824 | 99e44f844d78de330391f2b17bbf2e293bf24b1b | /pytorch/caffe2/quantization/server/group_norm_dnnlowp_op_test.py | b6acc900437ce89c4bd5c4ea17a400c9b8d47839 | [
"BSD-3-Clause",
"LicenseRef-scancode-generic-cla",
"Apache-2.0",
"BSD-2-Clause",
"MIT"
] | permissive | raghavnauhria/whatmt | be10d57bcd6134dd5714d0c4058abd56a1b35a13 | c20483a437c82936cb0fb8080925e37b9c4bba87 | refs/heads/master | 2022-12-04T05:39:24.601698 | 2019-07-22T09:43:30 | 2019-07-22T09:43:30 | 193,026,689 | 0 | 1 | MIT | 2022-11-28T17:50:19 | 2019-06-21T03:48:20 | C++ | UTF-8 | Python | false | false | 4,517 | py | from __future__ import absolute_import, division, print_function, unicode_literals
import collections
import caffe2.python.hypothesis_test_util as hu
import hypothesis.strategies as st
import numpy as np
from caffe2.python import core, dyndep, utils, workspace
from caffe2.quantization.server import utils as dnnlowp_u... | [
"rnauhria@gmail.com"
] | rnauhria@gmail.com |
2095829a72d1af19ee231c7ec670bf65766c274d | fd625e2ea155455c96261c8656a51be22fe420c8 | /Python/euler035.py | 4400059a3e93b485f3924881b3fe16cd51c435bb | [
"MIT"
] | permissive | AnuragAnalog/project_euler | 9b84a6aa0061ad4582c8d0059c3c1eaddd844fd2 | 8babbefbd5b7008ad24509f24a9d5f50ba208f45 | refs/heads/master | 2021-12-12T12:07:29.338791 | 2021-11-01T04:26:44 | 2021-11-01T04:26:44 | 210,749,964 | 6 | 16 | MIT | 2021-11-01T04:26:45 | 2019-09-25T03:44:37 | Python | UTF-8 | Python | false | false | 1,240 | py | #!/usr/bin/python3
"""
The number, 197, is called a circular prime because all rotations of the digits: 197, 971, and 719, are themselves prime.
There are thirteen such primes below 100: 2, 3, 5, 7, 11, 13, 17, 31, 37, 71, 73, 79, and 97.
How many circular primes are there below one million?
"""
import numpy as n... | [
"anurag.peddi1998@gmail.com"
] | anurag.peddi1998@gmail.com |
a7114ae73b29642ae1b3b76a8eca40595de9439d | df7f13ec34591fe1ce2d9aeebd5fd183e012711a | /hata/discord/embed/embed/tests/test__parse_author.py | fb71e365acb11fa7c73817ca0ef5c02ff77884b6 | [
"LicenseRef-scancode-warranty-disclaimer"
] | permissive | HuyaneMatsu/hata | 63e2f6a2d7a7539fd8f18498852d9d3fe5c41d2e | 53f24fdb38459dc5a4fd04f11bdbfee8295b76a4 | refs/heads/master | 2023-08-20T15:58:09.343044 | 2023-08-20T13:09:03 | 2023-08-20T13:09:03 | 163,677,173 | 3 | 3 | Apache-2.0 | 2019-12-18T03:46:12 | 2018-12-31T14:59:47 | Python | UTF-8 | Python | false | false | 481 | py | import vampytest
from ...embed_author import EmbedAuthor
from ..fields import parse_author
def test__parse_author():
"""
Tests whether ``parse_author`` works as intended.
"""
author = EmbedAuthor(name = 'hell')
for input_data, expected_output in (
({}, None),
({'author': Non... | [
"re.ism.tm@gmail.com"
] | re.ism.tm@gmail.com |
df22c26d03c9eb5404718fa0aee45e5b9bfd5116 | 9b422078f4ae22fe16610f2ebc54b8c7d905ccad | /xlsxwriter/test/comparison/test_image01.py | 81559d51c09a291a0dd6ef1c9b9f4f8d5f70ee88 | [
"BSD-2-Clause-Views"
] | permissive | projectsmahendra/XlsxWriter | 73d8c73ea648a911deea63cb46b9069fb4116b60 | 9b9d6fb283c89af8b6c89ad20f72b8208c2aeb45 | refs/heads/master | 2023-07-21T19:40:41.103336 | 2023-07-08T16:54:37 | 2023-07-08T16:54:37 | 353,636,960 | 0 | 0 | NOASSERTION | 2021-04-01T08:57:21 | 2021-04-01T08:57:20 | null | UTF-8 | Python | false | false | 1,149 | py | ###############################################################################
#
# Tests for XlsxWriter.
#
# Copyright (c), 2013-2021, John McNamara, jmcnamara@cpan.org
#
from ..excel_comparison_test import ExcelComparisonTest
from ...workbook import Workbook
class TestCompareXLSXFiles(ExcelComparisonTest):
"""... | [
"jmcnamara@cpan.org"
] | jmcnamara@cpan.org |
82e5f74cb9e4d564e4c9db40175c77111f664934 | 6b2a8dd202fdce77c971c412717e305e1caaac51 | /solutions_5630113748090880_1/Python/Hichamdz38/b.py | ec503006a405070048db8b02218200889a3eaef9 | [] | no_license | alexandraback/datacollection | 0bc67a9ace00abbc843f4912562f3a064992e0e9 | 076a7bc7693f3abf07bfdbdac838cb4ef65ccfcf | refs/heads/master | 2021-01-24T18:27:24.417992 | 2017-05-23T09:23:38 | 2017-05-23T09:23:38 | 84,313,442 | 2 | 4 | null | null | null | null | UTF-8 | Python | false | false | 309 | py | import numpy as np
for i in xrange(1,input()+1):
N=input()
z=np.array(N**2*2-N)
SS=[]
for j in xrange(N*2-1):
S=map(int,raw_input().split())
SS.extend(S)
f=[]
for j in SS:
if SS.count(j)%2!=0:
if j not in f:
f.append(j)
f.sort()
print "Case #{}:".format(i),
for j in f:
print j,
print | [
"alexandra1.back@gmail.com"
] | alexandra1.back@gmail.com |
b9be26523a79e0ed4ebc0819a2cf4003d2b1ee59 | ca7aa979e7059467e158830b76673f5b77a0f5a3 | /Python_codes/p02838/s053367568.py | d3c49f223dc225bd9cca1700aa01ef3296ab9707 | [] | no_license | Aasthaengg/IBMdataset | 7abb6cbcc4fb03ef5ca68ac64ba460c4a64f8901 | f33f1c5c3b16d0ea8d1f5a7d479ad288bb3f48d8 | refs/heads/main | 2023-04-22T10:22:44.763102 | 2021-05-13T17:27:22 | 2021-05-13T17:27:22 | 367,112,348 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,631 | py | # coding: utf-8
import sys
#from operator import itemgetter
sysread = sys.stdin.buffer.readline
read = sys.stdin.buffer.read
#from heapq import heappop, heappush
#from collections import defaultdict
sys.setrecursionlimit(10**7)
#import math
#from itertools import product, accumulate, combinations, product
#import bisec... | [
"66529651+Aastha2104@users.noreply.github.com"
] | 66529651+Aastha2104@users.noreply.github.com |
4fd3ad15ddd33c92cdffecb72052595b15ddd601 | 4beabdb5089e3284251dcaf046366c35d3afe02f | /rectangles.py | 06768e5dd0cb13903384183826b1e5920a411701 | [] | no_license | AndrewFendrich/Mandelbrot | c3fa2b1463d6e01b91ac0a3c53ef88c8e1716641 | 074ebd9028c13a9f840c2436ab2c8c3d2275dbf6 | refs/heads/master | 2021-01-13T00:52:24.060863 | 2017-05-08T14:30:02 | 2017-05-08T14:30:02 | 50,623,517 | 1 | 0 | null | null | null | null | UTF-8 | Python | false | false | 212 | py | # -*- coding: utf-8 -*-
"""
Created on Fri Nov 27 23:25:48 2015
@author: User
"""
import pygame
pygame.init()
rectangle = pygame.Rect(50,50,100,100)
print(rectangle)
rectangle.inflate_ip(2,2)
print(rectangle) | [
"admin@admin.com"
] | admin@admin.com |
80a1c18f8e69671ebde216c7d4f3665ff8b2181b | b281dd9e711d737579745914c6611d8cfaddb07d | /phones_media_files_demo/phones_media_files_demo/phones/migrations/0001_initial.py | c64a49f588e99ab5a1c3d237694ae76464f853d7 | [
"MIT"
] | permissive | Beshkov/Python-web-fundamentals | daf76f3765cb56e02bdaba8ea7df675990dd3885 | 6b0e9cc9725ea80a33c2ebde6e29f2ab585ab8d9 | refs/heads/main | 2023-08-03T07:04:22.238320 | 2021-09-12T18:57:36 | 2021-09-12T18:57:36 | 392,644,888 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 633 | py | # Generated by Django 3.2.6 on 2021-08-06 20:25
from django.db import migrations, models
class Migration(migrations.Migration):
initial = True
dependencies = [
]
operations = [
migrations.CreateModel(
name='Phone',
fields=[
('id', models.BigAutoField... | [
"alexander.beshkov@gmail.com"
] | alexander.beshkov@gmail.com |
54b5f81c202a4a9d48f25271d4ba743e2e4d049f | 4015e9d9cc72889b3494ae8b58e81dc507ae8d31 | /venv/Lib/site-packages/celery/bin/beat.py | faddd256a6bad3001f11a3074518b1a34db1463b | [] | no_license | Unlimit78/Test_For_DevelopsToday | 675676d3a477f590485722019bc1b1e1412b3926 | dc4e4ae887edf243adaca3a03c5fd3209ee60300 | refs/heads/master | 2022-12-17T18:41:33.511674 | 2020-09-15T18:13:53 | 2020-09-15T18:13:53 | 295,706,782 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 3,625 | py | # -*- coding: utf-8 -*-
"""The :program:`celery beat` command.
.. program:: celery beat
.. seealso::
See :ref:`preload-options` and :ref:`daemon-options`.
.. cmdoption:: --detach
Detach and run in the background as a daemon.
.. cmdoption:: -s, --schedule
Path to the schedule database. Defaults to `c... | [
"taras_ilyashchuk161@ukr.net"
] | taras_ilyashchuk161@ukr.net |
936b7b10e86cdeeaefe0e6f870ba20839b804f3d | 04a0614b8c2a893dab29bc4ffb0aaf82364fdf3f | /53. Maximum Subarray.py | 2fd8f5e141461dfc091e452ab1ffef6fc179a75e | [] | no_license | sharmaji27/Leetcode-Problems | 716bcb4a36b9e4f45274c4d551967e15c40ddbd2 | 0f878933b17df170c18f0b67b7200cec76c276e0 | refs/heads/master | 2021-10-20T17:35:35.175757 | 2021-10-20T05:33:17 | 2021-10-20T05:33:17 | 218,299,755 | 1 | 1 | null | null | null | null | UTF-8 | Python | false | false | 367 | py | class Solution:
def maxSubArray(self, nums: List[int]) -> int:
if len(nums)==1:
print(nums[0])
global_max = nums[0]
current_sum = nums[0]
for i in range(1,len(nums)):
current_sum = max(current_sum+nums[i],nums[i])
global_max = max(curre... | [
"asharma70420@gmail.com"
] | asharma70420@gmail.com |
fcfdfb2bf143fbabd9e7882777ff096eaec7745c | eeee18e2769766c550fb5e0948977a016b48e15a | /Creational/abstract-factory.py | 72d108161a2fa85440dac2ece3f9d6bf79735986 | [] | no_license | MoeinGhbh/DesignPattern | 19aff7bd09f4161d11af2662b1be7962fb692989 | b543a5c4eaf9da1341f95e9c777310d4f25ddeaf | refs/heads/master | 2022-11-18T17:49:56.101880 | 2020-07-22T07:54:23 | 2020-07-22T07:54:23 | 266,117,271 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,740 | py | """
Abstract Factory
Car => Benz, Bmw => Suv, Coupe
benz suv => gla, glc
bmw suv => x1, x2
benz coupe => cls, E-class
bmw coupe => m2, m4
"""
from abc import ABC,abstractclassmethod
class Car(ABC):
@abstractclassmethod
def call_suv(self):
pass
@abstractclassmethod
def call_coupe... | [
"="
] | = |
99a2478cea3c8d541d34c24dfcb9bc4ca59b0605 | 73b8aba05ee1424f38a8598a9f1305185588075f | /0x04-python-more_data_structures/9-multiply_by_2.py | 6a475a580fe3f50723c6e049968a98f01637a6dd | [] | no_license | nicolasportela/holbertonschool-higher_level_programming | 0d176c0e56f4f703c1e9a98b430fc6120f22f675 | e1537b81f21118456e5cfa0e4ed89520b232adb6 | refs/heads/master | 2023-04-20T21:30:22.693434 | 2021-05-13T01:47:30 | 2021-05-13T01:47:30 | 319,397,633 | 1 | 0 | null | null | null | null | UTF-8 | Python | false | false | 153 | py | #!/usr/bin/python3
def multiply_by_2(a_dictionary):
new_dic = {}
for k, v in a_dictionary.items():
new_dic[k] = v * 2
return new_dic
| [
"2103@holbertonschool.com"
] | 2103@holbertonschool.com |
aa2ad8ba0ff14340d3d7d30cd9b8fb24c00f071c | 6820e74ec72ed67f6b84a071cef9cfbc9830ad74 | /plans/tasks.py | 22acd6cb6cb911b7571adefb4585bd699ce306c6 | [
"MIT"
] | permissive | AppforallHQ/f5 | 96c15eaac3d7acc64e48d6741f26d78c9ef0d8cd | 0a85a5516e15d278ce30d1f7f339398831974154 | refs/heads/master | 2020-06-30T17:00:46.646867 | 2016-11-21T11:41:59 | 2016-11-21T11:41:59 | 74,357,925 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 3,047 | py | from celery import task
from django.utils import timezone
from datetime import timedelta
import requests
import json
class EndpointNotAvailabe(Exception):
pass
def call_external_endpoint_to_update_status(the_task, action, subscription):
payload = {"uuid": subscription.uuid,
"plan": subscriptio... | [
"hi@appforall.ir"
] | hi@appforall.ir |
753271955f78deae3afbada6c0d93276ade8e340 | 03bca281c8bb3ba69c3a01252cc7c9e35cd675bd | /django/DCC/dccApp/migrations/0001_initial.py | 63c611642310e159928a36aac3c2066355be6090 | [] | no_license | satish15625/pythonwork | 380fef04170064aef8aeb919a4e30f65db9a097f | 12d776152689a84f1560d08f35987f8ca4ea3fb0 | refs/heads/master | 2023-07-07T15:12:48.355226 | 2021-08-13T06:33:13 | 2021-08-13T06:33:13 | 374,058,740 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 562 | py | # Generated by Django 3.0.7 on 2020-12-15 12:25
from django.db import migrations, models
class Migration(migrations.Migration):
initial = True
dependencies = [
]
operations = [
migrations.CreateModel(
name='UploadImages',
fields=[
('id', models.AutoF... | [
"kumarsatish@dryicelabs.com"
] | kumarsatish@dryicelabs.com |
4eec63edb5849bedfb3c1094f0944238a960f578 | a81d84fdb57e1b90812fc5b5b523685ba5b663c0 | /python/2021_04/Question0769.py | 648c3a58f644d02e661df59e3decc996ad812c3d | [] | no_license | KujouNozom/LeetCode | 1919081001126924daa7549493a0823702631a37 | 4de1e601274de1336d669e41f732a8cb056880b9 | refs/heads/master | 2023-07-17T12:17:45.156451 | 2021-09-04T11:57:40 | 2021-09-04T11:57:40 | 268,075,373 | 3 | 0 | null | null | null | null | UTF-8 | Python | false | false | 516 | py | # 769. 最多能完成排序的块 [双指针]
from typing import List
class Solution:
def maxChunksToSorted(self, arr: List[int]) -> int:
min_value, max_value, start = 10, -1, 0
ans = 0
for index in range(len(arr)):
min_value = min(min_value, arr[index])
max_value = max(max_value, arr[in... | [
"438767738@qq.com"
] | 438767738@qq.com |
8e902e4e628a8d138844e6ee81c87d0dc785a0b1 | 4674b8088ffdf55905d44995f08a0792a3e4cd5c | /tests/hwsim/test_monitor_interface.py | bfc9a1562ff2e5c9fb7ee4dc4b08dfa12334195f | [
"BSD-3-Clause",
"BSD-2-Clause"
] | permissive | vanhoefm/krackattacks-scripts | 41daca791638a92aa4cfa68a582e46119037560e | 4b78669686f74efe664c6543b1b5b1616b22f902 | refs/heads/research | 2022-10-29T20:21:11.512335 | 2022-10-16T18:44:41 | 2022-10-16T18:44:41 | 107,408,514 | 2,184 | 577 | NOASSERTION | 2021-07-06T12:43:49 | 2017-10-18T12:58:08 | C | UTF-8 | Python | false | false | 3,271 | py | # AP mode using the older monitor interface design
# Copyright (c) 2013, Jouni Malinen <j@w1.fi>
#
# This software may be distributed under the terms of the BSD license.
# See README for more details.
from remotehost import remote_compatible
import logging
logger = logging.getLogger()
import time
import hwsim_utils
i... | [
"j@w1.fi"
] | j@w1.fi |
efc0ff16e064e56e714719076065e0481806106e | 951e433b25a25afeea4d9b45994a57e0a6044144 | /LeetCode/Q187_HM_findRepeatedDnaSequences.py | 4be93e56f1f5ce25527e7b244bc6bc2c45797d72 | [] | no_license | EricaEmmm/CodePython | 7c401073e0a9b7cd15f9f4a553f0aa3db1a951a3 | d52aa2a0bf71b5e7934ee7bff70d593a41b7e644 | refs/heads/master | 2020-05-31T14:00:34.266117 | 2019-09-22T09:48:23 | 2019-09-22T09:48:23 | 190,318,878 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,045 | py | # 重复的DNA序列
# 所有 DNA 由一系列缩写为 A，C，G 和 T 的核苷酸组成，例如：“ACGAATTCCG”。在研究 DNA 时，识别 DNA 中的重复序列有时会对研究非常有帮助
# 编写一个函数来查找 DNA 分子中所有出现超多一次的10个字母长的序列（子串）。
#
# 示例:
# 输入: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
# 输出: ["AAAAACCCCC", "CCCCCAAAAA"]
class Solution(object):
def findRepeatedDnaSequences(self, s):
"""
:type... | [
"1016920795@qq.com"
] | 1016920795@qq.com |
6c172d1d135b205d3134c570b5fea04025c05ba2 | ca7aa979e7059467e158830b76673f5b77a0f5a3 | /Python_codes/p02578/s304732693.py | fd8ac3cded43971a72e3cf659d1486c121afa2f5 | [] | no_license | Aasthaengg/IBMdataset | 7abb6cbcc4fb03ef5ca68ac64ba460c4a64f8901 | f33f1c5c3b16d0ea8d1f5a7d479ad288bb3f48d8 | refs/heads/main | 2023-04-22T10:22:44.763102 | 2021-05-13T17:27:22 | 2021-05-13T17:27:22 | 367,112,348 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 234 | py | n = int(input())
input_line = input().split()
member = [int(input_line[i]) for i in range(n)]
stands = 0
for i in range(1,n):
stand = member[i-1] - member[i]
if stand > 0:
stands += stand
member[i] += stand
print(stands) | [
"66529651+Aastha2104@users.noreply.github.com"
] | 66529651+Aastha2104@users.noreply.github.com |
b594ea5d9c012feedfb6dd74228118ce0300906b | 8d9318a33afc2c3b5ca8ac99fce0d8544478c94a | /Books/Casandra DB/opscenter-5.1.0/lib/py/html5lib/treebuilders/__init__.py | 50c8deeb08c187d8b51fcfdcb742e414c6ee52ab | [] | no_license | tushar239/git-large-repo | e30aa7b1894454bf00546312a3fb595f6dad0ed6 | 9ee51112596e5fc3a7ab2ea97a86ec6adc677162 | refs/heads/master | 2021-01-12T13:48:43.280111 | 2016-11-01T22:14:51 | 2016-11-01T22:14:51 | 69,609,373 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 129 | py | version https://git-lfs.github.com/spec/v1
oid sha256:b2a0b8030b4449b4e227ef389f48544f1136f27d0fc657128ee58812e529f7d3
size 4478
| [
"tushar239@gmail.com"
] | tushar239@gmail.com |
dda213c37af2f9c9c79342b1e51e552411080ec5 | 49ab501632b0a8336058406e7daa3afce6be6e93 | /python_server/run_keras_server.py | 14a25f5c8f258346bcedf3cf308c98eb4e1fbf53 | [] | no_license | CharlesFauman/meme_server | 3ab73e9788b9fea26f6ea270563381515d4b0d47 | 75b0d6fc041c1e2b04e260e9eecbff160225a0f6 | refs/heads/master | 2020-03-25T08:58:32.780593 | 2018-08-05T19:24:58 | 2018-08-05T19:24:58 | 143,640,946 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 4,029 | py | # USAGE
# Start the server:
# python run_keras_server.py
# Submit a request via cURL:
# curl -X POST -F image=@jemma.png 'http://localhost:5000/predict'
# Submita a request via Python:
# python simple_request.py
# import the necessary packages
import numpy as np
from threading import Thread
import flask
import redi... | [
"you@example.com"
] | you@example.com |
8f9536c2451f1c553693aed0b4015a05647789bf | 4b95aeb2533f0a582cea2fb26d6177e94aabb21f | /2020/src/lobby_layout.py | 3bba605d05757a8dc9695996a0304392f18ef81b | [] | no_license | MarcoBurgos/advent_of_code | 0d9984e0fa47f68e52ef0f5cdf7681e23767bd16 | 81ac54bfe200cc348efbe860bd95aae4270f03b7 | refs/heads/main | 2023-02-09T14:40:38.204271 | 2020-12-26T00:09:36 | 2020-12-26T00:09:36 | 317,739,393 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,687 | py | import sys
from utils import read_and_load_input
VECTORS = {
'w' : (-4, 0),
'e' : ( 4, 0),
'nw': (-2, -3),
'ne': ( 2, -3),
'sw': (-2, 3),
'se': ( 2, 3),
}
def parse(line):
result = []
while line:
stepLength = 1 if line[0] in ('e', 'w') else 2
result.append(line[:s... | [
"marko_burgos@gmail.com"
] | marko_burgos@gmail.com |
04c0a9aa06b8567653908c8159d470bb3be89b2d | 15f321878face2af9317363c5f6de1e5ddd9b749 | /solutions_python/Problem_200/5468.py | 063e5c8d196c9bfcca7a5d638432897002ca1793 | [] | no_license | dr-dos-ok/Code_Jam_Webscraper | c06fd59870842664cd79c41eb460a09553e1c80a | 26a35bf114a3aa30fc4c677ef069d95f41665cc0 | refs/heads/master | 2020-04-06T08:17:40.938460 | 2018-10-14T10:12:47 | 2018-10-14T10:12:47 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 290 | py | dirt=[]
k=1
t=input()
for j in range(t):
n=input();w=n
while(w):
c=0;g=n%10
n=w;q=(n)%10;m=-2
while(n):
d=n%10
if c>=1:
if q<d:
break
q=d;n/=10;
c+=1;g=d
if n==0:
dirt.append(w)
break
w=w-1
for i in dirt:
print "Case #{0}: {1}".format(k,i)
k+=1
| [
"miliar1732@gmail.com"
] | miliar1732@gmail.com |
a5ddd507e15815aaad86ceaaa47e2a295133f13d | 48e124e97cc776feb0ad6d17b9ef1dfa24e2e474 | /sdk/python/pulumi_azure_native/devices/v20160203/list_iot_hub_resource_keys.py | 42ce719ca651ad316e0363197087b52eff4ffe47 | [
"BSD-3-Clause",
"Apache-2.0"
] | permissive | bpkgoud/pulumi-azure-native | 0817502630062efbc35134410c4a784b61a4736d | a3215fe1b87fba69294f248017b1591767c2b96c | refs/heads/master | 2023-08-29T22:39:49.984212 | 2021-11-15T12:43:41 | 2021-11-15T12:43:41 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 3,383 | py | # coding=utf-8
# *** WARNING: this file was generated by the Pulumi SDK Generator. ***
# *** Do not edit by hand unless you're certain you know what you are doing! ***
import warnings
import pulumi
import pulumi.runtime
from typing import Any, Mapping, Optional, Sequence, Union, overload
from ... import _utilities
fro... | [
"noreply@github.com"
] | bpkgoud.noreply@github.com |
e7f28841c3cab7b1b034f5d0de68744734459162 | f8c35a47c7199aed0747e91e5c36ec97e7543de1 | /custom/icds_reports/management/commands/generate_migration_tables.py | 868e4fe59a2acf305643ee8eed39d62f19f82f18 | [] | no_license | dr-aryone/commcare-hq | 13a3f2a39382e3f6fe1f19d6c08bb61b808c146d | 3e7e09247fc8d1246ccfc77c1fff8603c9f65228 | refs/heads/master | 2020-05-27T14:29:48.923458 | 2019-05-26T00:01:33 | 2019-05-26T00:01:33 | 188,650,727 | 2 | 1 | null | 2019-05-26T07:03:18 | 2019-05-26T07:03:18 | null | UTF-8 | Python | false | false | 6,056 | py | from __future__ import absolute_import, print_function
from __future__ import unicode_literals
import logging
import re
import sqlite3
from django.core.management import CommandError
from django.core.management.base import BaseCommand
from sqlalchemy import inspect as sqlinspect
from corehq.apps.userreports.models i... | [
"skelly@dimagi.com"
] | skelly@dimagi.com |
19aab88df7aec32b7971ae1f9f4d9863c192e9e8 | 965fe92b03b37d2e6fa700281c4ef383fb104ada | /sciencebeam_trainer_delft/sequence_labelling/debug.py | 53a1befadf92215d50210611fddba0ded0508508 | [
"MIT"
] | permissive | elifesciences/sciencebeam-trainer-delft | 1591bebb7f5b9ed178329f4e9e02a9d893ab228d | 2413fe7f0801869208741e4ab6c4096db8d53b5e | refs/heads/develop | 2022-05-20T21:55:13.210432 | 2022-03-28T17:32:31 | 2022-03-28T17:32:31 | 192,557,708 | 5 | 1 | MIT | 2022-03-28T17:33:14 | 2019-06-18T14:34:50 | Python | UTF-8 | Python | false | false | 3,133 | py | import os
import logging
import time
from contextlib import contextmanager
from pathlib import Path
from typing import IO, Iterator, Optional
import numpy as np
from sciencebeam_trainer_delft.sequence_labelling.tag_formatter import (
TagOutputFormats,
format_tag_result
)
LOGGER = logging.getLogger(__name__)... | [
"noreply@github.com"
] | elifesciences.noreply@github.com |
d4ee6961649aca8865294008a94b35181bbe50bc | 54f352a242a8ad6ff5516703e91da61e08d9a9e6 | /Source Codes/CodeJamData/14/03/5.py | 44713545f4a1f6d56fb33b4f7f95aaa4764dea56 | [] | no_license | Kawser-nerd/CLCDSA | 5cbd8a4c3f65173e4e8e0d7ed845574c4770c3eb | aee32551795763b54acb26856ab239370cac4e75 | refs/heads/master | 2022-02-09T11:08:56.588303 | 2022-01-26T18:53:40 | 2022-01-26T18:53:40 | 211,783,197 | 23 | 9 | null | null | null | null | UTF-8 | Python | false | false | 1,620 | py | def trans(a):
return map(lambda x: ''.join(list(x)), zip(*a))
def can(r, c, m):
if r > c: r, c = c, r
safe = r * c - m
if r == 1 or safe == 1:
return True
elif r == 2:
return safe % 2 == 0 and safe >= 4
else:
return not safe in [2, 3, 5, 7]
def solve(r, c, m):
if n... | [
"kwnafi@yahoo.com"
] | kwnafi@yahoo.com |
b6176db9cf906b94b069180306ba7dc935c84b19 | 4061f9f2a7dc2acde4c4c630fbe10ac8f5913f5d | /user/views.py | 6059ac2806bf2a9c4bcdc72bc67893bae2b34d3b | [] | no_license | eibrahimarisoy/tasty_dishes | 8b9db3129c4d670f71a9e64025b25f51646c9e36 | ddfa3286bca06e153fbbd1e1a0d914c9f31d008e | refs/heads/master | 2022-12-04T00:45:55.607207 | 2020-04-03T09:42:31 | 2020-04-03T09:42:31 | 252,424,641 | 0 | 0 | null | 2022-11-22T05:27:25 | 2020-04-02T10:29:54 | JavaScript | UTF-8 | Python | false | false | 4,511 | py | from django.contrib import messages
from django.contrib.auth import authenticate, login, logout, update_session_auth_hash
from django.contrib.auth.decorators import login_required
from django.contrib.auth.forms import PasswordChangeForm
from django.contrib.auth.models import User
from django.shortcuts import get_object... | [
"eibrahimarisoy@gmail.com"
] | eibrahimarisoy@gmail.com |
fa3f5466ad8bcab2dadb823615e08fc9e14db94a | c0795000de54a26956efe1a87afba507bb328b81 | /docs/conf.py | ccd96e7307cb1b7e20bed096c7eb0dfae85de6c9 | [
"MIT"
] | permissive | steinitzu/beets | ff6c24d9e072b3d86f889e2b9af66a6ca2374d09 | 1fbbe6154698ce50f1a7e8d32af9a6376e2c7ede | refs/heads/master | 2021-01-16T20:26:07.732280 | 2013-02-28T18:43:02 | 2013-02-28T18:43:02 | 7,949,551 | 1 | 0 | null | null | null | null | UTF-8 | Python | false | false | 972 | py | AUTHOR = u'Adrian Sampson'
# -- General configuration -----------------------------------------------------
extensions = []
#templates_path = ['_templates']
exclude_patterns = ['_build']
source_suffix = '.rst'
master_doc = 'index'
project = u'beets'
copyright = u'2012, Adrian Sampson'
version = '1.1'
release = '1.... | [
"adrian@radbox.org"
] | adrian@radbox.org |
2ea747e7a97063f59f0d0d4584ff5c12e534398b | 90deb98bd63bdc0f08d80954d3edb3a277e63cd1 | /arq/jobs.py | 1d4c756caae0842df1a7973d086f698534b73085 | [
"MIT"
] | permissive | filmor/arq | 93a97852eb2aa554ce2c6d548fcfa7dac35b74b4 | f0b4b8b4db2df0c950069f98d5d62c104912e48d | refs/heads/master | 2020-03-13T21:08:36.514480 | 2018-01-10T15:36:23 | 2018-01-10T15:36:23 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 5,365 | py | """
:mod:`jobs`
===========
Defines the ``Job`` class and descendants which deal with encoding and decoding job data.
"""
import base64
import os
from datetime import datetime
import msgpack
from .utils import DEFAULT_CURTAIL, from_unix_ms, timestamp, to_unix_ms_tz, truncate
__all__ = ['JobSerialisationError', 'Job... | [
"s@muelcolvin.com"
] | s@muelcolvin.com |
f7b3033abbffc59bb77ce0801784a595aa9821d1 | 4be5c172c84e04c35677f5a327ab0ba592849676 | /python/leetcode/unique_paths_ii/unique_paths_ii.py | 3cdf92f1c359c3b7d2a6b32488d8026d34b9638a | [] | no_license | niranjan-nagaraju/Development | 3a16b547b030182867b7a44ac96a878c14058016 | d193ae12863971ac48a5ec9c0b35bfdf53b473b5 | refs/heads/master | 2023-04-06T20:42:57.882882 | 2023-03-31T18:38:40 | 2023-03-31T18:38:40 | 889,620 | 9 | 2 | null | 2019-05-27T17:00:29 | 2010-09-05T15:58:46 | Python | UTF-8 | Python | false | false | 3,955 | py | '''
https://leetcode.com/problems/unique-paths-ii/
63. Unique Paths II
A robot is located at the top-left corner of a m x n grid (marked 'Start' in the diagram below).
The robot can only move either down or right at any point in time. The robot is trying to reach the bottom-right corner of the grid (marked 'Finish' ... | [
"vinithepooh@gmail.com"
] | vinithepooh@gmail.com |
9c916129fe72fbdc76aaf2997d9bbdfa460fd235 | de54e5ddf4d350176d70c2bb1501b878285a18b8 | /fpn.py | 04a74603728490c73565dff2f7b4854aee3e9411 | [] | no_license | lizhe960118/find-star | e1d73b78b29087ca2e83990354b96b7406eaedf4 | e233dca4fe9a5faf6df9b6a4e0b2f29a7eb096b0 | refs/heads/master | 2020-05-18T10:55:52.008399 | 2019-05-01T03:49:32 | 2019-05-01T03:49:32 | 184,363,943 | 1 | 0 | null | null | null | null | UTF-8 | Python | false | false | 6,390 | py | '''RetinaFPN in PyTorch.'''
import torch
import torch.nn as nn
import torch.nn.functional as F
from torch.autograd import Variable
class Bottleneck(nn.Module):
expansion = 4
def __init__(self, in_planes, planes, stride=1):
super(Bottleneck, self).__init__()
self.conv1 = nn.Conv2d(in_planes, ... | [
"2957308424@qq.com"
] | 2957308424@qq.com |
95ad4fd20d715d2b592087416dd9db29358e23b9 | ca7aa979e7059467e158830b76673f5b77a0f5a3 | /Python_codes/p02407/s580407099.py | 11041f9012ef0a39f8fbc696d88e6c36fe254b03 | [] | no_license | Aasthaengg/IBMdataset | 7abb6cbcc4fb03ef5ca68ac64ba460c4a64f8901 | f33f1c5c3b16d0ea8d1f5a7d479ad288bb3f48d8 | refs/heads/main | 2023-04-22T10:22:44.763102 | 2021-05-13T17:27:22 | 2021-05-13T17:27:22 | 367,112,348 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 173 | py | n = int(input())
a = list(map(int,input().split()))
a.reverse()
for i,elem in enumerate(a):
if i != 0:
print (" ", end='')
print (elem, end='')
print ('')
| [
"66529651+Aastha2104@users.noreply.github.com"
] | 66529651+Aastha2104@users.noreply.github.com |
37416ae207a95ca269005d08f020dd3f0e703430 | 14de7abd1267122ad128c130f45ff86a087ed5cd | /nlp/match_blocks.py | 7e4efbe57c5b3b8a5ce86ca674e74a43cecd808f | [
"MIT"
] | permissive | saurabhXcode/tf-attentive-conv | 64124c470acdb26125680d903cc97ae1cc68a4b9 | 8dcc403575392c8e5c6c287432272a781410c49c | refs/heads/master | 2020-04-12T12:21:35.091291 | 2018-08-11T00:26:44 | 2018-08-11T00:26:44 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 3,308 | py | #!/usr/bin/env python
# -*- coding: utf-8 -*-
# Han Xiao <artex.xh@gmail.com> <https://hanxiao.github.io>
import tensorflow as tf
from nlp.encode_blocks import CNN_encode
from nlp.nn import linear_logit, dropout_res_layernorm
def AttentiveCNN_match(context, query, context_mask, query_mask,
sc... | [
"hanhxiao@tencent.com"
] | hanhxiao@tencent.com |
827370360a0c207ac6273117c06be4bf6b0b163e | 882be627c49870ae6f2f81963a3cfc9b719c0011 | /wscript | 601c17dd013a3c54bc088dbbc86fb37531affd98 | [] | no_license | brettviren/cogs | 794142a04c87ce148e939f8ded852dfa1f6df9bc | 681d1ed7e12cd2e7469a5ba3fd7261dc4f8f4c26 | refs/heads/master | 2022-11-30T12:26:19.624956 | 2020-08-10T12:34:44 | 2020-08-10T12:34:44 | 273,746,410 | 0 | 1 | null | 2020-08-10T12:34:45 | 2020-06-20T16:40:57 | JavaScript | UTF-8 | Python | false | false | 2,954 | #!/usr/bin/env waf
VERSION='0.0.0'
APPNAME='cogs'
import os.path as osp
def options(opt):
opt.load('compiler_cxx')
opt.load('waf_unit_test')
opt.add_option('--quell-tests', action='store_true', default=False,
help='Compile but do not run the tests (default=%default)')
opt.add_option... | [
"brett.viren@gmail.com"
] | brett.viren@gmail.com | |
cdc237084299675f5c218544154e89c2be810335 | 980434e03e722eaf3a5ff4ab4f1971c8d1cde4c5 | /宝石与石头.py | a2ae90f7262a28b814a440bfe3b1d2cf7a48bc01 | [] | no_license | arry-lee/arryleetcode | c9c548b0defc9771e4e488b3e760809364456c99 | b4b9b971ec81a921cca606dfa46ea4109d975dfb | refs/heads/master | 2020-07-26T14:11:27.645307 | 2019-09-15T23:31:09 | 2019-09-15T23:31:09 | 208,670,826 | 1 | 0 | null | null | null | null | WINDOWS-1252 | Python | false | false | 172 | py | #±¦Ê¯Óëʯͷ
#2019-08-17 06:20:13
class Solution:
def numJewelsInStones(self, J: str, S: str) -> int:
return len([stone for stone in S if stone in J]) | [
"arry_lee@qq.com"
] | arry_lee@qq.com |
ced152ee74e1836bdeb08bcfe32e146b988939d7 | 556db265723b0cc30ad2917442ed6dad92fd9044 | /tensorflow/python/training/experimental/mixed_precision_global_state.py | 6f0a179db65b1ebb31c2cbc1265eaf71b2a09fd6 | [
"MIT",
"Apache-2.0",
"BSD-2-Clause"
] | permissive | graphcore/tensorflow | c1669b489be0e045b3ec856b311b3139858de196 | 085b20a4b6287eff8c0b792425d52422ab8cbab3 | refs/heads/r2.6/sdk-release-3.2 | 2023-07-06T06:23:53.857743 | 2023-03-14T13:04:04 | 2023-03-14T13:48:43 | 162,717,602 | 84 | 17 | Apache-2.0 | 2023-03-25T01:13:37 | 2018-12-21T13:30:38 | C++ | UTF-8 | Python | false | false | 2,635 | py | # Copyright 2019 The TensorFlow Authors. All Rights Reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applica... | [
"gardener@tensorflow.org"
] | gardener@tensorflow.org |
09018e0be0d1189db97fad7103f982719fe99170 | e25b917f2f0ce28f6d046afaa9c0faddf0aeae34 | /Tutorials/split_and_merging.py | 0e4d372a63ff7e204d74bc9d502e062c6df0682b | [] | no_license | pmusau17/ComputerVision | d9344c22ed1fe1bf8a8c6166a060c307c08529a5 | 2fcdce0a967567c15232fe3c9f02982ca95e5796 | refs/heads/master | 2020-12-11T00:30:20.292943 | 2020-06-03T21:54:36 | 2020-06-03T21:54:36 | 233,751,710 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 786 | py | import numpy as np
import argparse
import cv2
#create argument parser
ap=argparse.ArgumentParser()
ap.add_argument('-i','--image', required=True)
args=vars(ap.parse_args())
#load the image
image=cv2.imread(args['image'])
(B,G,R)=cv2.split(image)
#this will display each of the channels as grayscale
cv2.imshow("Red"... | [
"pmusau13ster@gmail.com"
] | pmusau13ster@gmail.com |
17237a95039c4b7a5d68f70a91b7049b857dfa02 | 52b5773617a1b972a905de4d692540d26ff74926 | /.history/kmp_20200716201539.py | c0ccf11ea7faea0cd681296187ca576428e15267 | [] | no_license | MaryanneNjeri/pythonModules | 56f54bf098ae58ea069bf33f11ae94fa8eedcabc | f4e56b1e4dda2349267af634a46f6b9df6686020 | refs/heads/master | 2022-12-16T02:59:19.896129 | 2020-09-11T12:05:22 | 2020-09-11T12:05:22 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 785 | py | '''
Given a text txt[0..n-1] and a pattern pat[0..m-1],
write a function search(char pat[], char txt[]) that prints all occurrences of pat[] in txt[]. You may assume that n > m.
'''
def pattern(txt,pat):
# Catepillar algorithm
# we have a left and right pointer
# then the length of the search string
... | [
"mary.jereh@gmail.com"
] | mary.jereh@gmail.com |
d6db78cbc8e88ec12c049d25fffbbe429655373c | c22b9c7c4a854ed985e777bcbecd18870439b334 | /byteofpy/file.py | b2c51954e6226494b8066a0e68daaff28ff6f548 | [
"BSD-3-Clause"
] | permissive | pezy/python_test | ceb35a8a63ca8ebe26ffa5c72ace664718c7b328 | b019a0d9f267b5071c37fc85c9acaf27e9146625 | refs/heads/master | 2021-01-19T01:09:20.820202 | 2016-07-30T08:35:15 | 2016-07-30T08:35:15 | 18,096,404 | 0 | 2 | null | null | null | null | UTF-8 | Python | false | false | 415 | py | poem = '''\
Programming is fun
When the work is done
if you wanna make your work also fun:
use Python!
'''
# Open for writing
f = open('poem.txt', 'w')
# Write text to file
f.write(poem)
f.close()
# If no mode is specified
# Read mode is assumed by default
f = open('poem.txt')
while True:
line = f.readline()
... | [
"urbancpz@gmail.com"
] | urbancpz@gmail.com |
2d5ee23a8cba0fea02e4f205bafc24f5c98fc027 | 375e5bca82843647941068bd7634cf7adf2015ca | /tests/test_transforms_resize_modulo_pad_crop.py | f72a33b918735569e106f2221c7a10a6e1392d92 | [
"MIT"
] | permissive | civodlu/trw | cd57e7bded7fdb0a9d623ed9cd50645fab96583b | 11c59dea0072d940b036166be22b392bb9e3b066 | refs/heads/master | 2023-02-08T09:56:39.203340 | 2023-02-07T14:22:16 | 2023-02-07T14:22:16 | 195,147,670 | 12 | 2 | MIT | 2020-10-19T15:24:11 | 2019-07-04T01:19:31 | Python | UTF-8 | Python | false | false | 1,864 | py | import unittest
import trw
import torch
import numpy as np
class TestTransformsResizeModuloPadCrop(unittest.TestCase):
def test_crop_mode_torch(self):
batch = {
'images': torch.rand([2, 3, 64, 64], dtype=torch.float32)
}
tfm = trw.transforms.TransformResizeModuloCropPad(60)
... | [
"civodlu@gmail.com"
] | civodlu@gmail.com |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.