contestId int64 0 1.01k | index stringclasses 57
values | name stringlengths 2 58 | type stringclasses 2
values | rating int64 0 3.5k | tags listlengths 0 11 | title stringclasses 522
values | time-limit stringclasses 8
values | memory-limit stringclasses 8
values | problem-description stringlengths 0 7.15k | input-specification stringlengths 0 2.05k | output-specification stringlengths 0 1.5k | demo-input listlengths 0 7 | demo-output listlengths 0 7 | note stringlengths 0 5.24k | points float64 0 425k | test_cases listlengths 0 402 | creationTimeSeconds int64 1.37B 1.7B | relativeTimeSeconds int64 8 2.15B | programmingLanguage stringclasses 3
values | verdict stringclasses 14
values | testset stringclasses 12
values | passedTestCount int64 0 1k | timeConsumedMillis int64 0 15k | memoryConsumedBytes int64 0 805M | code stringlengths 3 65.5k | prompt stringlengths 262 8.2k | response stringlengths 17 65.5k | score float64 -1 3.99 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
75 | B | Facetook Priority Wall | PROGRAMMING | 1,500 | [
"expression parsing",
"implementation",
"strings"
] | B. Facetook Priority Wall | 2 | 256 | Facetook is a well known social network website, and it will launch a new feature called Facetook Priority Wall. This feature will sort all posts from your friends according to the priority factor (it will be described).
This priority factor will be affected by three types of actions:
- 1. "*X* posted on *Y*'s wall... | The first line contains your name. The second line contains an integer *n*, which is the number of actions (1<=≤<=*n*<=≤<=100). Then *n* lines follow, it is guaranteed that each one contains exactly 1 action in the format given above. There is exactly one space between each two words in a line, and there are no extra s... | Print *m* lines, where *m* is the number of distinct names in the input (excluding yourself). Each line should contain just 1 name. The names should be sorted according to the priority factor with you in the descending order (the highest priority factor should come first). If two or more names have the same priority fa... | [
"ahmed\n3\nahmed posted on fatma's wall\nfatma commented on ahmed's post\nmona likes ahmed's post\n",
"aba\n1\nlikes likes posted's post\n"
] | [
"fatma\nmona\n",
"likes\nposted\n"
] | none | 1,000 | [
{
"input": "ahmed\n3\nahmed posted on fatma's wall\nfatma commented on ahmed's post\nmona likes ahmed's post",
"output": "fatma\nmona"
},
{
"input": "aba\n1\nlikes likes posted's post",
"output": "likes\nposted"
},
{
"input": "nu\n5\ng commented on pwyndmh's post\nqv posted on g's wall\n... | 1,684,246,725 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 60 | 124 | 0 | class Chain:
def __init__(self, f, s):
self.f = f
self.s = s
me = input()
n = int(input())
mp = {}
for i in range(n):
a = list(map(str, input().split()))
if a[1] == "likes":
ot = a[2]
else:
ot = a[3]
# parse the name
her = ""
for j in ... | Title: Facetook Priority Wall
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Facetook is a well known social network website, and it will launch a new feature called Facetook Priority Wall. This feature will sort all posts from your friends according to the priority factor (it will be describ... | ```python
class Chain:
def __init__(self, f, s):
self.f = f
self.s = s
me = input()
n = int(input())
mp = {}
for i in range(n):
a = list(map(str, input().split()))
if a[1] == "likes":
ot = a[2]
else:
ot = a[3]
# parse the name
her = ""
... | 3.969 |
32 | B | Borze | PROGRAMMING | 800 | [
"expression parsing",
"implementation"
] | B. Borze | 2 | 256 | Ternary numeric notation is quite popular in Berland. To telegraph the ternary number the Borze alphabet is used. Digit 0 is transmitted as «.», 1 as «-.» and 2 as «--». You are to decode the Borze code, i.e. to find out the ternary number given its representation in Borze alphabet. | The first line contains a number in Borze code. The length of the string is between 1 and 200 characters. It's guaranteed that the given string is a valid Borze code of some ternary number (this number can have leading zeroes). | Output the decoded ternary number. It can have leading zeroes. | [
".-.--\n",
"--.\n",
"-..-.--\n"
] | [
"012",
"20",
"1012"
] | none | 1,000 | [
{
"input": ".-.--",
"output": "012"
},
{
"input": "--.",
"output": "20"
},
{
"input": "-..-.--",
"output": "1012"
},
{
"input": "---..",
"output": "210"
},
{
"input": "..--.---..",
"output": "0020210"
},
{
"input": "-.....----.",
"output": "1000022... | 1,649,009,325 | 2,147,483,647 | Python 3 | OK | TESTS | 30 | 92 | 0 | s = input()
def just_print(s):
print(s, sep = "", end = "")
dashed = False
for c in s:
if dashed:
dashed = False
if c == '.':
just_print(1)
elif c == '-':
just_print(2)
elif c == '-':
dashed = True
else:
just_print(0) | Title: Borze
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Ternary numeric notation is quite popular in Berland. To telegraph the ternary number the Borze alphabet is used. Digit 0 is transmitted as «.», 1 as «-.» and 2 as «--». You are to decode the Borze code, i.e. to find out the ternary ... | ```python
s = input()
def just_print(s):
print(s, sep = "", end = "")
dashed = False
for c in s:
if dashed:
dashed = False
if c == '.':
just_print(1)
elif c == '-':
just_print(2)
elif c == '-':
dashed = True
else:
just_pri... | 3.977 |
707 | A | Brain's Photos | PROGRAMMING | 800 | [
"implementation"
] | null | null | Small, but very brave, mouse Brain was not accepted to summer school of young villains. He was upset and decided to postpone his plans of taking over the world, but to become a photographer instead.
As you may know, the coolest photos are on the film (because you can specify the hashtag #film for such).
Brain took a ... | The first line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the number of photo pixel matrix rows and columns respectively.
Then *n* lines describing matrix rows follow. Each of them contains *m* space-separated characters describing colors of pixels in a row. Each character in the line i... | Print the "#Black&White" (without quotes), if the photo is black-and-white and "#Color" (without quotes), if it is colored, in the only line. | [
"2 2\nC M\nY Y\n",
"3 2\nW W\nW W\nB B\n",
"1 1\nW\n"
] | [
"#Color",
"#Black&White",
"#Black&White"
] | none | 500 | [
{
"input": "2 2\nC M\nY Y",
"output": "#Color"
},
{
"input": "3 2\nW W\nW W\nB B",
"output": "#Black&White"
},
{
"input": "1 1\nW",
"output": "#Black&White"
},
{
"input": "2 3\nW W W\nB G Y",
"output": "#Color"
},
{
"input": "1 1\nW",
"output": "#Black&White"
... | 1,692,955,733 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 15 | 0 | m,n = map(int,input().split())
a = []
for i in range(m):
a.append([str(j) for j in input().split()])
s=set()
for i in range(m):
for j in range (n):
s.add(a[i][j])
if "C" in s or "M" in s or "Y" in s or "G" in s:
print("#Color")
print(s)
else:
print("#Black&White") | Title: Brain's Photos
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Small, but very brave, mouse Brain was not accepted to summer school of young villains. He was upset and decided to postpone his plans of taking over the world, but to become a photographer instead.
As you may know, the... | ```python
m,n = map(int,input().split())
a = []
for i in range(m):
a.append([str(j) for j in input().split()])
s=set()
for i in range(m):
for j in range (n):
s.add(a[i][j])
if "C" in s or "M" in s or "Y" in s or "G" in s:
print("#Color")
print(s)
else:
print("#Black&White"... | 0 | |
379 | A | New Year Candles | PROGRAMMING | 1,000 | [
"implementation"
] | null | null | Vasily the Programmer loves romance, so this year he decided to illuminate his room with candles.
Vasily has *a* candles.When Vasily lights up a new candle, it first burns for an hour and then it goes out. Vasily is smart, so he can make *b* went out candles into a new candle. As a result, this new candle can be used ... | The single line contains two integers, *a* and *b* (1<=≤<=*a*<=≤<=1000; 2<=≤<=*b*<=≤<=1000). | Print a single integer — the number of hours Vasily can light up the room for. | [
"4 2\n",
"6 3\n"
] | [
"7\n",
"8\n"
] | Consider the first sample. For the first four hours Vasily lights up new candles, then he uses four burned out candles to make two new ones and lights them up. When these candles go out (stop burning), Vasily can make another candle. Overall, Vasily can light up the room for 7 hours. | 500 | [
{
"input": "4 2",
"output": "7"
},
{
"input": "6 3",
"output": "8"
},
{
"input": "1000 1000",
"output": "1001"
},
{
"input": "123 5",
"output": "153"
},
{
"input": "1000 2",
"output": "1999"
},
{
"input": "1 2",
"output": "1"
},
{
"input": ... | 1,693,578,358 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 4 | 31 | 0 | a,b=list(map(int,input().split(" ")))
res=a
li=res
while(li>=b):
li/=b
res+=round(li)
print(res) | Title: New Year Candles
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasily the Programmer loves romance, so this year he decided to illuminate his room with candles.
Vasily has *a* candles.When Vasily lights up a new candle, it first burns for an hour and then it goes out. Vasily is s... | ```python
a,b=list(map(int,input().split(" ")))
res=a
li=res
while(li>=b):
li/=b
res+=round(li)
print(res)
``` | 0 | |
0 | none | none | none | 0 | [
"none"
] | null | null | In order to put away old things and welcome a fresh new year, a thorough cleaning of the house is a must.
Little Tommy finds an old polynomial and cleaned it up by taking it modulo another. But now he regrets doing this...
Given two integers *p* and *k*, find a polynomial *f*(*x*) with non-negative integer coefficien... | The only line of input contains two space-separated integers *p* and *k* (1<=≤<=*p*<=≤<=1018, 2<=≤<=*k*<=≤<=2<=000). | If the polynomial does not exist, print a single integer -1, or output two lines otherwise.
In the first line print a non-negative integer *d* — the number of coefficients in the polynomial.
In the second line print *d* space-separated integers *a*0,<=*a*1,<=...,<=*a**d*<=-<=1, describing a polynomial fulfilling the... | [
"46 2\n",
"2018 214\n"
] | [
"7\n0 1 0 0 1 1 1\n",
"3\n92 205 1\n"
] | In the first example, *f*(*x*) = *x*<sup class="upper-index">6</sup> + *x*<sup class="upper-index">5</sup> + *x*<sup class="upper-index">4</sup> + *x* = (*x*<sup class="upper-index">5</sup> - *x*<sup class="upper-index">4</sup> + 3*x*<sup class="upper-index">3</sup> - 6*x*<sup class="upper-index">2</sup> + 12*x* - 23)·... | 0 | [
{
"input": "46 2",
"output": "7\n0 1 0 0 1 1 1"
},
{
"input": "2018 214",
"output": "3\n92 205 1"
},
{
"input": "4 2",
"output": "3\n0 0 1"
},
{
"input": "5 2",
"output": "3\n1 0 1"
},
{
"input": "10 3",
"output": "3\n1 0 1"
},
{
"input": "250 1958",
... | 1,518,615,190 | 5,290 | PyPy 3 | WRONG_ANSWER | PRETESTS | 5 | 77 | 19,968,000 | # import sys
# sys.stdin = open('in.txt', 'r')
p, k = map(int, input().split())
b = []
for i in range(200):
if i == 0:
if p%k == 0:
b.append(-p//k)
else:
b.append(-p//k+1)
else:
if b[i-1]%k == 0:
b.append(-b[i-1]//k)
else:
b.append... | Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In order to put away old things and welcome a fresh new year, a thorough cleaning of the house is a must.
Little Tommy finds an old polynomial and cleaned it up by taking it modulo another. But now he regrets doing this...
Given... | ```python
# import sys
# sys.stdin = open('in.txt', 'r')
p, k = map(int, input().split())
b = []
for i in range(200):
if i == 0:
if p%k == 0:
b.append(-p//k)
else:
b.append(-p//k+1)
else:
if b[i-1]%k == 0:
b.append(-b[i-1]//k)
else:
... | 0 | |
902 | A | Visiting a Friend | PROGRAMMING | 1,100 | [
"greedy",
"implementation"
] | null | null | Pig is visiting a friend.
Pig's house is located at point 0, and his friend's house is located at point *m* on an axis.
Pig can use teleports to move along the axis.
To use a teleport, Pig should come to a certain point (where the teleport is located) and choose where to move: for each teleport there is the rightmos... | The first line contains two integers *n* and *m* (1<=≤<=*n*<=≤<=100,<=1<=≤<=*m*<=≤<=100) — the number of teleports and the location of the friend's house.
The next *n* lines contain information about teleports.
The *i*-th of these lines contains two integers *a**i* and *b**i* (0<=≤<=*a**i*<=≤<=*b**i*<=≤<=*m*), where ... | Print "YES" if there is a path from Pig's house to his friend's house that uses only teleports, and "NO" otherwise.
You can print each letter in arbitrary case (upper or lower). | [
"3 5\n0 2\n2 4\n3 5\n",
"3 7\n0 4\n2 5\n6 7\n"
] | [
"YES\n",
"NO\n"
] | The first example is shown on the picture below:
Pig can use the first teleport from his house (point 0) to reach point 2, then using the second teleport go from point 2 to point 3, then using the third teleport go from point 3 to point 5, where his friend lives.
The second example is shown on the picture below:
You... | 500 | [
{
"input": "3 5\n0 2\n2 4\n3 5",
"output": "YES"
},
{
"input": "3 7\n0 4\n2 5\n6 7",
"output": "NO"
},
{
"input": "1 1\n0 0",
"output": "NO"
},
{
"input": "30 10\n0 7\n1 2\n1 2\n1 4\n1 4\n1 3\n2 2\n2 4\n2 6\n2 9\n2 2\n3 5\n3 8\n4 8\n4 5\n4 6\n5 6\n5 7\n6 6\n6 9\n6 7\n6 9\n7 7... | 1,513,915,688 | 1,088 | Python 3 | OK | TESTS | 55 | 62 | 5,632,000 |
n, m = map(int, input().split())
cur = 0
for _ in range(n):
x, y = map(int, input().split())
if (x <= cur):
cur = max(cur,y)
if (cur >= m):
print("YES")
else:
print("NO") | Title: Visiting a Friend
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Pig is visiting a friend.
Pig's house is located at point 0, and his friend's house is located at point *m* on an axis.
Pig can use teleports to move along the axis.
To use a teleport, Pig should come to a certain ... | ```python
n, m = map(int, input().split())
cur = 0
for _ in range(n):
x, y = map(int, input().split())
if (x <= cur):
cur = max(cur,y)
if (cur >= m):
print("YES")
else:
print("NO")
``` | 3 | |
987 | A | Infinity Gauntlet | PROGRAMMING | 800 | [
"implementation"
] | null | null | You took a peek on Thanos wearing Infinity Gauntlet. In the Gauntlet there is a place for six Infinity Gems:
- the Power Gem of purple color, - the Time Gem of green color, - the Space Gem of blue color, - the Soul Gem of orange color, - the Reality Gem of red color, - the Mind Gem of yellow color.
Using colors... | In the first line of input there is one integer $n$ ($0 \le n \le 6$) — the number of Gems in Infinity Gauntlet.
In next $n$ lines there are colors of Gems you saw. Words used for colors are: purple, green, blue, orange, red, yellow. It is guaranteed that all the colors are distinct. All colors are given in lowercase ... | In the first line output one integer $m$ ($0 \le m \le 6$) — the number of absent Gems.
Then in $m$ lines print the names of absent Gems, each on its own line. Words used for names are: Power, Time, Space, Soul, Reality, Mind. Names can be printed in any order. Keep the first letter uppercase, others lowercase. | [
"4\nred\npurple\nyellow\norange\n",
"0\n"
] | [
"2\nSpace\nTime\n",
"6\nTime\nMind\nSoul\nPower\nReality\nSpace\n"
] | In the first sample Thanos already has Reality, Power, Mind and Soul Gems, so he needs two more: Time and Space.
In the second sample Thanos doesn't have any Gems, so he needs all six. | 500 | [
{
"input": "4\nred\npurple\nyellow\norange",
"output": "2\nSpace\nTime"
},
{
"input": "0",
"output": "6\nMind\nSpace\nPower\nTime\nReality\nSoul"
},
{
"input": "6\npurple\nblue\nyellow\nred\ngreen\norange",
"output": "0"
},
{
"input": "1\npurple",
"output": "5\nTime\nReal... | 1,579,467,619 | 2,147,483,647 | Python 3 | OK | TESTS | 64 | 109 | 307,200 | n = int(input())
gems = { 'purple': 'Power', 'green':'Time', 'blue':'Space', 'orange':'Soul', 'red':'Reality', 'yellow':'Mind' }
count = 6
missing = [ 'Power', 'Time', 'Space', 'Soul', 'Reality', 'Mind']
for _ in range(n):
s = input()
missing.remove(gems[s])
count -= 1
print(count)
for _ in missing... | Title: Infinity Gauntlet
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You took a peek on Thanos wearing Infinity Gauntlet. In the Gauntlet there is a place for six Infinity Gems:
- the Power Gem of purple color, - the Time Gem of green color, - the Space Gem of blue color, - the So... | ```python
n = int(input())
gems = { 'purple': 'Power', 'green':'Time', 'blue':'Space', 'orange':'Soul', 'red':'Reality', 'yellow':'Mind' }
count = 6
missing = [ 'Power', 'Time', 'Space', 'Soul', 'Reality', 'Mind']
for _ in range(n):
s = input()
missing.remove(gems[s])
count -= 1
print(count)
for _ ... | 3 | |
320 | B | Ping-Pong (Easy Version) | PROGRAMMING | 1,500 | [
"dfs and similar",
"graphs"
] | null | null | In this problem at each moment you have a set of intervals. You can move from interval (*a*,<=*b*) from our set to interval (*c*,<=*d*) from our set if and only if *c*<=<<=*a*<=<<=*d* or *c*<=<<=*b*<=<<=*d*. Also there is a path from interval *I*1 from our set to interval *I*2 from our set if there is a seq... | The first line of the input contains integer *n* denoting the number of queries, (1<=≤<=*n*<=≤<=100). Each of the following lines contains a query as described above. All numbers in the input are integers and don't exceed 109 by their absolute value.
It's guaranteed that all queries are correct. | For each query of the second type print "YES" or "NO" on a separate line depending on the answer. | [
"5\n1 1 5\n1 5 11\n2 1 2\n1 2 9\n2 1 2\n"
] | [
"NO\nYES\n"
] | none | 1,000 | [
{
"input": "5\n1 1 5\n1 5 11\n2 1 2\n1 2 9\n2 1 2",
"output": "NO\nYES"
},
{
"input": "10\n1 -311 -186\n1 -1070 -341\n1 -1506 -634\n1 688 1698\n2 2 4\n1 70 1908\n2 1 2\n2 2 4\n1 -1053 1327\n2 5 4",
"output": "NO\nNO\nNO\nYES"
},
{
"input": "10\n1 -1365 -865\n1 1244 1834\n2 1 2\n1 -1508 -... | 1,632,476,836 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 3 | 124 | 20,172,800 | def dfs(adj, vis, v):
global flag
vis[v] = True
for u in adj[v]:
if not vis[u]:
dfs(adj, vis, u)
n = int(input())
adj = []
intervals = []
icount = 0
for _ in range(n):
query = [int(x) for x in input().split()]
if query[0] == 1:
ls, x, y = [], query[1], query[2]
... | Title: Ping-Pong (Easy Version)
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In this problem at each moment you have a set of intervals. You can move from interval (*a*,<=*b*) from our set to interval (*c*,<=*d*) from our set if and only if *c*<=<<=*a*<=<<=*d* or *c*<=<<=*b*<=&... | ```python
def dfs(adj, vis, v):
global flag
vis[v] = True
for u in adj[v]:
if not vis[u]:
dfs(adj, vis, u)
n = int(input())
adj = []
intervals = []
icount = 0
for _ in range(n):
query = [int(x) for x in input().split()]
if query[0] == 1:
ls, x, y = [], query[1], query[2... | 0 | |
644 | C | Hostname Aliases | PROGRAMMING | 2,100 | [
"*special",
"binary search",
"data structures",
"implementation",
"sortings",
"strings"
] | null | null | There are some websites that are accessible through several different addresses. For example, for a long time Codeforces was accessible with two hostnames codeforces.com and codeforces.ru.
You are given a list of page addresses being queried. For simplicity we consider all addresses to have the form http://<hostnam... | The first line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=100<=000) — the number of page queries. Then follow *n* lines each containing exactly one address. Each address is of the form http://<hostname>[/<path>], where:
- <hostname> consists of lowercase English letters and dots, ther... | First print *k* — the number of groups of server names that correspond to one website. You should count only groups of size greater than one.
Next *k* lines should contain the description of groups, one group per line. For each group print all server names separated by a single space. You are allowed to print both gro... | [
"10\nhttp://abacaba.ru/test\nhttp://abacaba.ru/\nhttp://abacaba.com\nhttp://abacaba.com/test\nhttp://abacaba.de/\nhttp://abacaba.ru/test\nhttp://abacaba.de/test\nhttp://abacaba.com/\nhttp://abacaba.com/t\nhttp://abacaba.com/test\n",
"14\nhttp://c\nhttp://ccc.bbbb/aba..b\nhttp://cba.com\nhttp://a.c/aba..b/a\nhttp:... | [
"1\nhttp://abacaba.de http://abacaba.ru \n",
"2\nhttp://cba.com http://ccc.bbbb \nhttp://a.a.a http://a.c http://abc \n"
] | none | 1,500 | [
{
"input": "10\nhttp://abacaba.ru/test\nhttp://abacaba.ru/\nhttp://abacaba.com\nhttp://abacaba.com/test\nhttp://abacaba.de/\nhttp://abacaba.ru/test\nhttp://abacaba.de/test\nhttp://abacaba.com/\nhttp://abacaba.com/t\nhttp://abacaba.com/test",
"output": "1\nhttp://abacaba.de http://abacaba.ru "
},
{
"... | 1,458,163,851 | 45,051 | Python 3 | WRONG_ANSWER | PRETESTS | 0 | 46 | 0 | n = int(input())
w = {}
for g in range(n):
s = input().split('/')
s[2] = 'http://' + s[2]
if not(w.get(s[2])):
w[s[2]] = set(s[3:])
else:
w[s[2]] = w[s[2]].union(s[3:])
bad = set()
for name, s in w.items():
bad.add(name)
for name2, s2 in w.items():
if name2 in bad: continue
if s == s2: print(name, na... | Title: Hostname Aliases
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are some websites that are accessible through several different addresses. For example, for a long time Codeforces was accessible with two hostnames codeforces.com and codeforces.ru.
You are given a list of page... | ```python
n = int(input())
w = {}
for g in range(n):
s = input().split('/')
s[2] = 'http://' + s[2]
if not(w.get(s[2])):
w[s[2]] = set(s[3:])
else:
w[s[2]] = w[s[2]].union(s[3:])
bad = set()
for name, s in w.items():
bad.add(name)
for name2, s2 in w.items():
if name2 in bad: continue
if s == s2: prin... | 0 | |
754 | A | Lesha and array splitting | PROGRAMMING | 1,200 | [
"constructive algorithms",
"greedy",
"implementation"
] | null | null | One spring day on his way to university Lesha found an array *A*. Lesha likes to split arrays into several parts. This time Lesha decided to split the array *A* into several, possibly one, new arrays so that the sum of elements in each of the new arrays is not zero. One more condition is that if we place the new arrays... | The first line contains single integer *n* (1<=≤<=*n*<=≤<=100) — the number of elements in the array *A*.
The next line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=103<=≤<=*a**i*<=≤<=103) — the elements of the array *A*. | If it is not possible to split the array *A* and satisfy all the constraints, print single line containing "NO" (without quotes).
Otherwise in the first line print "YES" (without quotes). In the next line print single integer *k* — the number of new arrays. In each of the next *k* lines print two integers *l**i* and *... | [
"3\n1 2 -3\n",
"8\n9 -12 3 4 -4 -10 7 3\n",
"1\n0\n",
"4\n1 2 3 -5\n"
] | [
"YES\n2\n1 2\n3 3\n",
"YES\n2\n1 2\n3 8\n",
"NO\n",
"YES\n4\n1 1\n2 2\n3 3\n4 4\n"
] | none | 500 | [
{
"input": "3\n1 2 -3",
"output": "YES\n3\n1 1\n2 2\n3 3"
},
{
"input": "8\n9 -12 3 4 -4 -10 7 3",
"output": "YES\n8\n1 1\n2 2\n3 3\n4 4\n5 5\n6 6\n7 7\n8 8"
},
{
"input": "1\n0",
"output": "NO"
},
{
"input": "4\n1 2 3 -5",
"output": "YES\n4\n1 1\n2 2\n3 3\n4 4"
},
{
... | 1,641,376,331 | 2,147,483,647 | Python 3 | COMPILATION_ERROR | TESTS | 0 | 0 | 0 | a=int(input())
l=list(map(int,input().split()))
i=1
while(i<a) and l[i-1]<l[i]:
i=i+1
while(i<a) and l[i-1]==l[i]:
i=i+1
while(i<a) and l[i-1]>l[i]:
i=i+1
if(i==a):
print("Yes")
else:
print("No")
[03/01, 5:03 pm] +91 99959 59240: a=int(input())
for i in range(a):
n=int(input())
... | Title: Lesha and array splitting
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One spring day on his way to university Lesha found an array *A*. Lesha likes to split arrays into several parts. This time Lesha decided to split the array *A* into several, possibly one, new arrays so that t... | ```python
a=int(input())
l=list(map(int,input().split()))
i=1
while(i<a) and l[i-1]<l[i]:
i=i+1
while(i<a) and l[i-1]==l[i]:
i=i+1
while(i<a) and l[i-1]>l[i]:
i=i+1
if(i==a):
print("Yes")
else:
print("No")
[03/01, 5:03 pm] +91 99959 59240: a=int(input())
for i in range(a):
n=int(i... | -1 | |
41 | A | Translation | PROGRAMMING | 800 | [
"implementation",
"strings"
] | A. Translation | 2 | 256 | The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc.... | The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols. | If the word *t* is a word *s*, written reversely, print YES, otherwise print NO. | [
"code\nedoc\n",
"abb\naba\n",
"code\ncode\n"
] | [
"YES\n",
"NO\n",
"NO\n"
] | none | 500 | [
{
"input": "code\nedoc",
"output": "YES"
},
{
"input": "abb\naba",
"output": "NO"
},
{
"input": "code\ncode",
"output": "NO"
},
{
"input": "abacaba\nabacaba",
"output": "YES"
},
{
"input": "q\nq",
"output": "YES"
},
{
"input": "asrgdfngfnmfgnhweratgjkk... | 1,694,612,742 | 2,147,483,647 | Python 3 | OK | TESTS | 40 | 92 | 0 | A=input()
B=input()
A1=A[::-1]
if A1==B:
print("YES")
else:
print("NO") | Title: Translation
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pron... | ```python
A=input()
B=input()
A1=A[::-1]
if A1==B:
print("YES")
else:
print("NO")
``` | 3.977 |
472 | A | Design Tutorial: Learn from Math | PROGRAMMING | 800 | [
"math",
"number theory"
] | null | null | One way to create a task is to learn from math. You can generate some random math statement or modify some theorems to get something new and build a new task from that.
For example, there is a statement called the "Goldbach's conjecture". It says: "each even number no less than four can be expressed as the sum of two ... | The only line contains an integer *n* (12<=≤<=*n*<=≤<=106). | Output two composite integers *x* and *y* (1<=<<=*x*,<=*y*<=<<=*n*) such that *x*<=+<=*y*<==<=*n*. If there are multiple solutions, you can output any of them. | [
"12\n",
"15\n",
"23\n",
"1000000\n"
] | [
"4 8\n",
"6 9\n",
"8 15\n",
"500000 500000\n"
] | In the first example, 12 = 4 + 8 and both 4, 8 are composite numbers. You can output "6 6" or "8 4" as well.
In the second example, 15 = 6 + 9. Note that you can't output "1 14" because 1 is not a composite number. | 500 | [
{
"input": "12",
"output": "4 8"
},
{
"input": "15",
"output": "6 9"
},
{
"input": "23",
"output": "8 15"
},
{
"input": "1000000",
"output": "500000 500000"
},
{
"input": "63874",
"output": "4 63870"
},
{
"input": "14568",
"output": "4 14564"
},
... | 1,682,129,981 | 2,147,483,647 | Python 3 | OK | TESTS | 33 | 108 | 0 | def prime(n):
for i in range(2,n//2+1):
if n%i==0:
return False
return True
n=int(input())
for i in range(2,n):
if prime(i)==False and prime(n-i)==False:
print(i,n-i)
break | Title: Design Tutorial: Learn from Math
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One way to create a task is to learn from math. You can generate some random math statement or modify some theorems to get something new and build a new task from that.
For example, there is a statemen... | ```python
def prime(n):
for i in range(2,n//2+1):
if n%i==0:
return False
return True
n=int(input())
for i in range(2,n):
if prime(i)==False and prime(n-i)==False:
print(i,n-i)
break
``` | 3 | |
11 | A | Increasing Sequence | PROGRAMMING | 900 | [
"constructive algorithms",
"implementation",
"math"
] | A. Increasing Sequence | 1 | 64 | A sequence *a*0,<=*a*1,<=...,<=*a**t*<=-<=1 is called increasing if *a**i*<=-<=1<=<<=*a**i* for each *i*:<=0<=<<=*i*<=<<=*t*.
You are given a sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 and a positive integer *d*. In each move you may choose one element of the given sequence and add *d* to it. What is the least... | The first line of the input contains two integer numbers *n* and *d* (2<=≤<=*n*<=≤<=2000,<=1<=≤<=*d*<=≤<=106). The second line contains space separated sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 (1<=≤<=*b**i*<=≤<=106). | Output the minimal number of moves needed to make the sequence increasing. | [
"4 2\n1 3 3 2\n"
] | [
"3\n"
] | none | 0 | [
{
"input": "4 2\n1 3 3 2",
"output": "3"
},
{
"input": "2 1\n1 1",
"output": "1"
},
{
"input": "2 1\n2 5",
"output": "0"
},
{
"input": "2 1\n1 2",
"output": "0"
},
{
"input": "2 1\n1 1",
"output": "1"
},
{
"input": "2 7\n10 20",
"output": "0"
},
... | 1,686,529,140 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 62 | 0 | n,d=map(int,input().split())
a=list(map(int,input().split()))
l=0
for i in range(1,len(a)):
k = 0
k = (a[i-1]-a[i]//d)+1
print(k)
| Title: Increasing Sequence
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
A sequence *a*0,<=*a*1,<=...,<=*a**t*<=-<=1 is called increasing if *a**i*<=-<=1<=<<=*a**i* for each *i*:<=0<=<<=*i*<=<<=*t*.
You are given a sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 and a positive integer *d*... | ```python
n,d=map(int,input().split())
a=list(map(int,input().split()))
l=0
for i in range(1,len(a)):
k = 0
k = (a[i-1]-a[i]//d)+1
print(k)
``` | 0 |
102 | B | Sum of Digits | PROGRAMMING | 1,000 | [
"implementation"
] | B. Sum of Digits | 2 | 265 | Having watched the last Harry Potter film, little Gerald also decided to practice magic. He found in his father's magical book a spell that turns any number in the sum of its digits. At the moment Gerald learned that, he came across a number *n*. How many times can Gerald put a spell on it until the number becomes one-... | The first line contains the only integer *n* (0<=≤<=*n*<=≤<=10100000). It is guaranteed that *n* doesn't contain any leading zeroes. | Print the number of times a number can be replaced by the sum of its digits until it only contains one digit. | [
"0\n",
"10\n",
"991\n"
] | [
"0\n",
"1\n",
"3\n"
] | In the first sample the number already is one-digit — Herald can't cast a spell.
The second test contains number 10. After one casting of a spell it becomes 1, and here the process is completed. Thus, Gerald can only cast the spell once.
The third test contains number 991. As one casts a spell the following transform... | 1,000 | [
{
"input": "0",
"output": "0"
},
{
"input": "10",
"output": "1"
},
{
"input": "991",
"output": "3"
},
{
"input": "99",
"output": "2"
},
{
"input": "100",
"output": "1"
},
{
"input": "123456789",
"output": "2"
},
{
"input": "32",
"output... | 1,684,846,087 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 0 | 92 | 0 | def digital_root(n):
if n < 10:
return 0
sum_digits = sum(int(digit) for digit in str(n))
return 1 + digital_root(sum_digits)
| Title: Sum of Digits
Time Limit: 2 seconds
Memory Limit: 265 megabytes
Problem Description:
Having watched the last Harry Potter film, little Gerald also decided to practice magic. He found in his father's magical book a spell that turns any number in the sum of its digits. At the moment Gerald learned that, he came... | ```python
def digital_root(n):
if n < 10:
return 0
sum_digits = sum(int(digit) for digit in str(n))
return 1 + digital_root(sum_digits)
``` | 0 |
109 | B | Lucky Probability | PROGRAMMING | 1,900 | [
"brute force",
"probabilities"
] | B. Lucky Probability | 2 | 256 | Petya loves lucky numbers. We all know that lucky numbers are the positive integers whose decimal representations contain only the lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not.
Petya and his friend Vasya play an interesting game. Petya randomly chooses an integer *p* from the ... | The single line contains five integers *p**l*, *p**r*, *v**l*, *v**r* and *k* (1<=≤<=*p**l*<=≤<=*p**r*<=≤<=109,<=1<=≤<=*v**l*<=≤<=*v**r*<=≤<=109,<=1<=≤<=*k*<=≤<=1000). | On the single line print the result with an absolute error of no more than 10<=-<=9. | [
"1 10 1 10 2\n",
"5 6 8 10 1\n"
] | [
"0.320000000000\n",
"1.000000000000\n"
] | Consider that [*a*, *b*] denotes an interval of integers; this interval includes the boundaries. That is, <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/18b4a6012d95ad18891561410f0314497a578d63.png" style="max-width: 100.0%;max-height: 100.0%;"/>
In first case there are 32 suitable pairs:... | 1,000 | [
{
"input": "1 10 1 10 2",
"output": "0.320000000000"
},
{
"input": "5 6 8 10 1",
"output": "1.000000000000"
},
{
"input": "1 20 100 120 5",
"output": "0.150000000000"
},
{
"input": "1 10 1 10 3",
"output": "0.000000000000"
},
{
"input": "1 100 1 100 2",
"outpu... | 1,697,994,485 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 62 | 102,400 | def main():
inp = input().split()
p1, p2, v1, v2, k = map(int, inp)
probability = 0
# +1 потому что скобки квадратные, мы включаем границы
all_possible_exoduses = (p2 - p1 + 1) * (v2 - v1 + 1)
all_k_lucky_combinations = score_all_k_lucky_combinations(
k, find_all_lucky_numbers(p... | Title: Lucky Probability
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Petya loves lucky numbers. We all know that lucky numbers are the positive integers whose decimal representations contain only the lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not.
P... | ```python
def main():
inp = input().split()
p1, p2, v1, v2, k = map(int, inp)
probability = 0
# +1 потому что скобки квадратные, мы включаем границы
all_possible_exoduses = (p2 - p1 + 1) * (v2 - v1 + 1)
all_k_lucky_combinations = score_all_k_lucky_combinations(
k, find_all_lucky... | 0 |
253 | C | Text Editor | PROGRAMMING | 1,600 | [
"data structures",
"dfs and similar",
"graphs",
"greedy",
"shortest paths"
] | null | null | Vasya is pressing the keys on the keyboard reluctantly, squeezing out his ideas on the classical epos depicted in Homer's Odysseus... How can he explain to his literature teacher that he isn't going to become a writer? In fact, he is going to become a programmer. So, he would take great pleasure in writing a program, b... | The first line of the input contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the file. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=105), separated by single spaces. The third line contains four integers *r*1,<=*c*1,<=*r*2,<=*c*2 (1<=≤<=*r*1,<=*r*2<=≤<=*n*,<=1<=... | Print a single integer — the minimum number of times Vasya should push a key to move the cursor from position (*r*1,<=*c*1) to position (*r*2,<=*c*2). | [
"4\n2 1 6 4\n3 4 4 2\n",
"4\n10 5 6 4\n1 11 4 2\n",
"3\n10 1 10\n1 10 1 1\n"
] | [
"3\n",
"6\n",
"3\n"
] | In the first sample the editor contains four lines. Let's represent the cursor's possible positions in the line as numbers. Letter *s* represents the cursor's initial position, letter *t* represents the last one. Then all possible positions of the cursor in the text editor are described by the following table.
123
12... | 1,500 | [
{
"input": "4\n2 1 6 4\n3 4 4 2",
"output": "3"
},
{
"input": "4\n10 5 6 4\n1 11 4 2",
"output": "6"
},
{
"input": "3\n10 1 10\n1 10 1 1",
"output": "3"
},
{
"input": "4\n2 1 6 4\n4 2 3 5",
"output": "4"
},
{
"input": "3\n20 3 20\n1 20 1 1",
"output": "5"
},... | 1,620,644,227 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 92 | 6,963,200 | class Solution_once:
def singleNumber(self, arr):
ones, twos = 0, 0
for x in arr:
ones, twos = (ones ^ x) & ~twos, (ones & x) | (twos & ~x)
assert twos == 0
return ones
class Solution_twice:
def single_number(arr):
ones, twos, threes = 0, 0, 0
for x in... | Title: Text Editor
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya is pressing the keys on the keyboard reluctantly, squeezing out his ideas on the classical epos depicted in Homer's Odysseus... How can he explain to his literature teacher that he isn't going to become a writer? In f... | ```python
class Solution_once:
def singleNumber(self, arr):
ones, twos = 0, 0
for x in arr:
ones, twos = (ones ^ x) & ~twos, (ones & x) | (twos & ~x)
assert twos == 0
return ones
class Solution_twice:
def single_number(arr):
ones, twos, threes = 0, 0, 0
... | 0 | |
80 | A | Panoramix's Prediction | PROGRAMMING | 800 | [
"brute force"
] | A. Panoramix's Prediction | 2 | 256 | A prime number is a number which has exactly two distinct divisors: one and itself. For example, numbers 2, 7, 3 are prime, and 1, 6, 4 are not.
The next prime number after *x* is the smallest prime number greater than *x*. For example, the next prime number after 2 is 3, and the next prime number after 3 is 5. Note t... | The first and only input line contains two positive integers — *n* and *m* (2<=≤<=*n*<=<<=*m*<=≤<=50). It is guaranteed that *n* is prime.
Pretests contain all the cases with restrictions 2<=≤<=*n*<=<<=*m*<=≤<=4. | Print YES, if *m* is the next prime number after *n*, or NO otherwise. | [
"3 5\n",
"7 11\n",
"7 9\n"
] | [
"YES",
"YES",
"NO"
] | none | 500 | [
{
"input": "3 5",
"output": "YES"
},
{
"input": "7 11",
"output": "YES"
},
{
"input": "7 9",
"output": "NO"
},
{
"input": "2 3",
"output": "YES"
},
{
"input": "2 4",
"output": "NO"
},
{
"input": "3 4",
"output": "NO"
},
{
"input": "3 5",
... | 1,675,415,536 | 2,147,483,647 | PyPy 3 | RUNTIME_ERROR | TESTS | 39 | 186 | 2,150,400 | primes = [2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37, 41, 43, 47]
n, m = map(int, input().split())
print("YES") if primes[primes.index(n) + 1] == m else print("NO")
| Title: Panoramix's Prediction
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
A prime number is a number which has exactly two distinct divisors: one and itself. For example, numbers 2, 7, 3 are prime, and 1, 6, 4 are not.
The next prime number after *x* is the smallest prime number greater t... | ```python
primes = [2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37, 41, 43, 47]
n, m = map(int, input().split())
print("YES") if primes[primes.index(n) + 1] == m else print("NO")
``` | -1 |
0 | none | none | none | 0 | [
"none"
] | null | null | Vasya has *n* days of vacations! So he decided to improve his IT skills and do sport. Vasya knows the following information about each of this *n* days: whether that gym opened and whether a contest was carried out in the Internet on that day. For the *i*-th day there are four options:
1. on this day the gym is close... | The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100) — the number of days of Vasya's vacations.
The second line contains the sequence of integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=3) separated by space, where:
- *a**i* equals 0, if on the *i*-th day of vacations the gym is closed and the co... | Print the minimum possible number of days on which Vasya will have a rest. Remember that Vasya refuses:
- to do sport on any two consecutive days, - to write the contest on any two consecutive days. | [
"4\n1 3 2 0\n",
"7\n1 3 3 2 1 2 3\n",
"2\n2 2\n"
] | [
"2\n",
"0\n",
"1\n"
] | In the first test Vasya can write the contest on the day number 1 and do sport on the day number 3. Thus, he will have a rest for only 2 days.
In the second test Vasya should write contests on days number 1, 3, 5 and 7, in other days do sport. Thus, he will not have a rest for a single day.
In the third test Vasya ca... | 0 | [
{
"input": "4\n1 3 2 0",
"output": "2"
},
{
"input": "7\n1 3 3 2 1 2 3",
"output": "0"
},
{
"input": "2\n2 2",
"output": "1"
},
{
"input": "1\n0",
"output": "1"
},
{
"input": "10\n0 0 1 1 0 0 0 0 1 0",
"output": "8"
},
{
"input": "100\n3 2 3 3 3 2 3 1 ... | 1,468,938,650 | 5,150 | Python 3 | WRONG_ANSWER | PRETESTS | 5 | 77 | 307,200 | from sys import stdin
def remplir(inf,sup,val):
global programme
for i in range(inf,sup+1):
programme[i]=val
val=(val+1)%2
n=int(input())+2
programme=list(map(int,stdin.readline().split()))
programme=[0]+programme
programme.append(0)
chaines=[]
anta... | Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya has *n* days of vacations! So he decided to improve his IT skills and do sport. Vasya knows the following information about each of this *n* days: whether that gym opened and whether a contest was carried out in the Internet... | ```python
from sys import stdin
def remplir(inf,sup,val):
global programme
for i in range(inf,sup+1):
programme[i]=val
val=(val+1)%2
n=int(input())+2
programme=list(map(int,stdin.readline().split()))
programme=[0]+programme
programme.append(0)
chaine... | 0 | |
839 | A | Arya and Bran | PROGRAMMING | 900 | [
"implementation"
] | null | null | Bran and his older sister Arya are from the same house. Bran like candies so much, so Arya is going to give him some Candies.
At first, Arya and Bran have 0 Candies. There are *n* days, at the *i*-th day, Arya finds *a**i* candies in a box, that is given by the Many-Faced God. Every day she can give Bran at most 8 of ... | The first line contains two integers *n* and *k* (1<=≤<=*n*<=≤<=100, 1<=≤<=*k*<=≤<=10000).
The second line contains *n* integers *a*1,<=*a*2,<=*a*3,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=100). | If it is impossible for Arya to give Bran *k* candies within *n* days, print -1.
Otherwise print a single integer — the minimum number of days Arya needs to give Bran *k* candies before the end of the *n*-th day. | [
"2 3\n1 2\n",
"3 17\n10 10 10\n",
"1 9\n10\n"
] | [
"2",
"3",
"-1"
] | In the first sample, Arya can give Bran 3 candies in 2 days.
In the second sample, Arya can give Bran 17 candies in 3 days, because she can give him at most 8 candies per day.
In the third sample, Arya can't give Bran 9 candies, because she can give him at most 8 candies per day and she must give him the candies with... | 500 | [
{
"input": "2 3\n1 2",
"output": "2"
},
{
"input": "3 17\n10 10 10",
"output": "3"
},
{
"input": "1 9\n10",
"output": "-1"
},
{
"input": "10 70\n6 5 2 3 3 2 1 4 3 2",
"output": "-1"
},
{
"input": "20 140\n40 4 81 40 10 54 34 50 84 60 16 1 90 78 38 93 99 60 81 99",... | 1,643,627,934 | 2,147,483,647 | Python 3 | OK | TESTS | 60 | 31 | 0 | n, k = map(int, input().split())
v = list(map(int, input().split()))
t = 0
i = 0
for i in range(0, n):
t += v[i]
x = min(8, t)
k -= x
t -= x
if k <= 0:
break
print([i + 1, -1][k > 0])
| Title: Arya and Bran
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bran and his older sister Arya are from the same house. Bran like candies so much, so Arya is going to give him some Candies.
At first, Arya and Bran have 0 Candies. There are *n* days, at the *i*-th day, Arya finds *a**... | ```python
n, k = map(int, input().split())
v = list(map(int, input().split()))
t = 0
i = 0
for i in range(0, n):
t += v[i]
x = min(8, t)
k -= x
t -= x
if k <= 0:
break
print([i + 1, -1][k > 0])
``` | 3 | |
894 | A | QAQ | PROGRAMMING | 800 | [
"brute force",
"dp"
] | null | null | "QAQ" is a word to denote an expression of crying. Imagine "Q" as eyes with tears and "A" as a mouth.
Now Diamond has given Bort a string consisting of only uppercase English letters of length *n*. There is a great number of "QAQ" in the string (Diamond is so cute!).
Bort wants to know how many subsequences "QAQ" are... | The only line contains a string of length *n* (1<=≤<=*n*<=≤<=100). It's guaranteed that the string only contains uppercase English letters. | Print a single integer — the number of subsequences "QAQ" in the string. | [
"QAQAQYSYIOIWIN\n",
"QAQQQZZYNOIWIN\n"
] | [
"4\n",
"3\n"
] | In the first example there are 4 subsequences "QAQ": "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN". | 500 | [
{
"input": "QAQAQYSYIOIWIN",
"output": "4"
},
{
"input": "QAQQQZZYNOIWIN",
"output": "3"
},
{
"input": "QA",
"output": "0"
},
{
"input": "IAQVAQZLQBQVQFTQQQADAQJA",
"output": "24"
},
{
"input": "QQAAQASGAYAAAAKAKAQIQEAQAIAAIAQQQQQ",
"output": "378"
},
{
... | 1,617,297,759 | 2,147,483,647 | Python 3 | OK | TESTS | 43 | 62 | 0 | a=input()
print(sum(a[:i].count('Q')*a[i:].count('Q') for i in range(len(a)) if a[i]=='A')) | Title: QAQ
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
"QAQ" is a word to denote an expression of crying. Imagine "Q" as eyes with tears and "A" as a mouth.
Now Diamond has given Bort a string consisting of only uppercase English letters of length *n*. There is a great number of "QAQ"... | ```python
a=input()
print(sum(a[:i].count('Q')*a[i:].count('Q') for i in range(len(a)) if a[i]=='A'))
``` | 3 | |
272 | A | Dima and Friends | PROGRAMMING | 1,000 | [
"implementation",
"math"
] | null | null | Dima and his friends have been playing hide and seek at Dima's place all night. As a result, Dima's place got messy. In the morning they decided that they need to clean the place.
To decide who exactly would clean the apartment, the friends want to play a counting-out game. First, all the guys stand in a circle, and t... | The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of Dima's friends. Dima himself isn't considered to be his own friend. The second line contains *n* positive integers, not exceeding 5, representing, how many fingers the Dima's friends will show.
The numbers in the lines are separated by a single s... | In a single line print the answer to the problem. | [
"1\n1\n",
"1\n2\n",
"2\n3 5\n"
] | [
"3\n",
"2\n",
"3\n"
] | In the first sample Dima can show 1, 3 or 5 fingers. If Dima shows 3 fingers, then the counting-out will go like that: Dima, his friend, Dima, his friend.
In the second sample Dima can show 2 or 4 fingers. | 500 | [
{
"input": "1\n1",
"output": "3"
},
{
"input": "1\n2",
"output": "2"
},
{
"input": "2\n3 5",
"output": "3"
},
{
"input": "2\n3 5",
"output": "3"
},
{
"input": "1\n5",
"output": "3"
},
{
"input": "5\n4 4 3 5 1",
"output": "4"
},
{
"input": "... | 1,682,695,919 | 2,147,483,647 | Python 3 | OK | TESTS | 30 | 92 | 0 | n=int(input())
f=list(map(int,input().split()))
b = sum(f)
c = 0
for x in range(1, 6):
if (x + b) % (n+1) != 1:
c += 1
print(c) | Title: Dima and Friends
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Dima and his friends have been playing hide and seek at Dima's place all night. As a result, Dima's place got messy. In the morning they decided that they need to clean the place.
To decide who exactly would clean the... | ```python
n=int(input())
f=list(map(int,input().split()))
b = sum(f)
c = 0
for x in range(1, 6):
if (x + b) % (n+1) != 1:
c += 1
print(c)
``` | 3 | |
43 | A | Football | PROGRAMMING | 1,000 | [
"strings"
] | A. Football | 2 | 256 | One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. E... | The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the description. Then follow *n* lines — for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match di... | Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner. | [
"1\nABC\n",
"5\nA\nABA\nABA\nA\nA\n"
] | [
"ABC\n",
"A\n"
] | none | 500 | [
{
"input": "1\nABC",
"output": "ABC"
},
{
"input": "5\nA\nABA\nABA\nA\nA",
"output": "A"
},
{
"input": "2\nXTSJEP\nXTSJEP",
"output": "XTSJEP"
},
{
"input": "3\nXZYDJAEDZ\nXZYDJAEDZ\nXZYDJAEDZ",
"output": "XZYDJAEDZ"
},
{
"input": "3\nQCCYXL\nQCCYXL\nAXGLFQDD",
... | 1,657,288,179 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 1 | 60 | 0 | dic={}
for i in range(int(input())):
goal=input()
if goal in dic.keys():
dic[goal]+=1
else:
dic[goal]=1
print(max(dic)) | Title: Football
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process... | ```python
dic={}
for i in range(int(input())):
goal=input()
if goal in dic.keys():
dic[goal]+=1
else:
dic[goal]=1
print(max(dic))
``` | 0 |
41 | A | Translation | PROGRAMMING | 800 | [
"implementation",
"strings"
] | A. Translation | 2 | 256 | The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc.... | The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols. | If the word *t* is a word *s*, written reversely, print YES, otherwise print NO. | [
"code\nedoc\n",
"abb\naba\n",
"code\ncode\n"
] | [
"YES\n",
"NO\n",
"NO\n"
] | none | 500 | [
{
"input": "code\nedoc",
"output": "YES"
},
{
"input": "abb\naba",
"output": "NO"
},
{
"input": "code\ncode",
"output": "NO"
},
{
"input": "abacaba\nabacaba",
"output": "YES"
},
{
"input": "q\nq",
"output": "YES"
},
{
"input": "asrgdfngfnmfgnhweratgjkk... | 1,612,180,684 | 2,147,483,647 | Python 3 | OK | TESTS | 40 | 124 | 0 | t = input()
s = input()
if(s=="".join(reversed(t))):
print('YES')
else:
print('NO')
| Title: Translation
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pron... | ```python
t = input()
s = input()
if(s=="".join(reversed(t))):
print('YES')
else:
print('NO')
``` | 3.969 |
608 | B | Hamming Distance Sum | PROGRAMMING | 1,500 | [
"combinatorics",
"strings"
] | null | null | Genos needs your help. He was asked to solve the following programming problem by Saitama:
The length of some string *s* is denoted |*s*|. The Hamming distance between two strings *s* and *t* of equal length is defined as , where *s**i* is the *i*-th character of *s* and *t**i* is the *i*-th character of *t*. For exam... | The first line of the input contains binary string *a* (1<=≤<=|*a*|<=≤<=200<=000).
The second line of the input contains binary string *b* (|*a*|<=≤<=|*b*|<=≤<=200<=000).
Both strings are guaranteed to consist of characters '0' and '1' only. | Print a single integer — the sum of Hamming distances between *a* and all contiguous substrings of *b* of length |*a*|. | [
"01\n00111\n",
"0011\n0110\n"
] | [
"3\n",
"2\n"
] | For the first sample case, there are four contiguous substrings of *b* of length |*a*|: "00", "01", "11", and "11". The distance between "01" and "00" is |0 - 0| + |1 - 0| = 1. The distance between "01" and "01" is |0 - 0| + |1 - 1| = 0. The distance between "01" and "11" is |0 - 1| + |1 - 1| = 1. Last distance counts ... | 1,000 | [
{
"input": "01\n00111",
"output": "3"
},
{
"input": "0011\n0110",
"output": "2"
},
{
"input": "0\n0",
"output": "0"
},
{
"input": "1\n0",
"output": "1"
},
{
"input": "0\n1",
"output": "1"
},
{
"input": "1\n1",
"output": "0"
},
{
"input": "1... | 1,651,488,509 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 8 | 2,000 | 78,028,800 | x=input()
y=input()
sum=''
i=0
lx=len(x)
while(i+lx<=len(y)):
ans=int(x,2) ^ int(y[i:i+lx],2)
ans=bin(ans)[2:]
sum+=ans
i+=1
out=sum.count("1")
print(out)
| Title: Hamming Distance Sum
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Genos needs your help. He was asked to solve the following programming problem by Saitama:
The length of some string *s* is denoted |*s*|. The Hamming distance between two strings *s* and *t* of equal length is de... | ```python
x=input()
y=input()
sum=''
i=0
lx=len(x)
while(i+lx<=len(y)):
ans=int(x,2) ^ int(y[i:i+lx],2)
ans=bin(ans)[2:]
sum+=ans
i+=1
out=sum.count("1")
print(out)
``` | 0 | |
59 | A | Word | PROGRAMMING | 800 | [
"implementation",
"strings"
] | A. Word | 2 | 256 | Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At th... | The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100. | Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one. | [
"HoUse\n",
"ViP\n",
"maTRIx\n"
] | [
"house\n",
"VIP\n",
"matrix\n"
] | none | 500 | [
{
"input": "HoUse",
"output": "house"
},
{
"input": "ViP",
"output": "VIP"
},
{
"input": "maTRIx",
"output": "matrix"
},
{
"input": "BNHWpnpawg",
"output": "bnhwpnpawg"
},
{
"input": "VTYGP",
"output": "VTYGP"
},
{
"input": "CHNenu",
"output": "chn... | 1,614,921,166 | 2,147,483,647 | Python 3 | OK | TESTS | 30 | 124 | 0 | s=input()
c1=c2=0
for i in range(len(s)):
if s[i].islower():
c1=c1+1
elif s[i].isupper():
c2=c2+1
if c1>c2 or c1==c2:
s=s.lower()
elif c2>c1:
s=s.upper()
print(s)
| Title: Word
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it ei... | ```python
s=input()
c1=c2=0
for i in range(len(s)):
if s[i].islower():
c1=c1+1
elif s[i].isupper():
c2=c2+1
if c1>c2 or c1==c2:
s=s.lower()
elif c2>c1:
s=s.upper()
print(s)
``` | 3.969 |
25 | A | IQ test | PROGRAMMING | 1,300 | [
"brute force"
] | A. IQ test | 2 | 256 | Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — to check his answers, he needs a program that among the given *n* numbers finds one that i... | The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of numbers in the task. The second line contains *n* space-separated natural numbers, not exceeding 100. It is guaranteed, that exactly one of these numbers differs from the others in evenness. | Output index of number that differs from the others in evenness. Numbers are numbered from 1 in the input order. | [
"5\n2 4 7 8 10\n",
"4\n1 2 1 1\n"
] | [
"3\n",
"2\n"
] | none | 0 | [
{
"input": "5\n2 4 7 8 10",
"output": "3"
},
{
"input": "4\n1 2 1 1",
"output": "2"
},
{
"input": "3\n1 2 2",
"output": "1"
},
{
"input": "3\n100 99 100",
"output": "2"
},
{
"input": "3\n5 3 2",
"output": "3"
},
{
"input": "4\n43 28 1 91",
"output"... | 1,610,403,747 | 2,147,483,647 | PyPy 3 | OK | TESTS | 32 | 186 | 0 | if __name__ == '__main__':
n = int(input())
ls = list(map(int, input().split()))
evens = []
odds = []
for x in ls:
if x % 2 == 0:
evens.append(x)
else:
odds.append(x)
if len(odds) == 1:
x = odds[0]
else:
x = evens[0]
f... | Title: IQ test
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — t... | ```python
if __name__ == '__main__':
n = int(input())
ls = list(map(int, input().split()))
evens = []
odds = []
for x in ls:
if x % 2 == 0:
evens.append(x)
else:
odds.append(x)
if len(odds) == 1:
x = odds[0]
else:
x = evens... | 3.9535 |
978 | A | Remove Duplicates | PROGRAMMING | 800 | [
"implementation"
] | null | null | Petya has an array $a$ consisting of $n$ integers. He wants to remove duplicate (equal) elements.
Petya wants to leave only the rightmost entry (occurrence) for each element of the array. The relative order of the remaining unique elements should not be changed. | The first line contains a single integer $n$ ($1 \le n \le 50$) — the number of elements in Petya's array.
The following line contains a sequence $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 1\,000$) — the Petya's array. | In the first line print integer $x$ — the number of elements which will be left in Petya's array after he removed the duplicates.
In the second line print $x$ integers separated with a space — Petya's array after he removed the duplicates. For each unique element only the rightmost entry should be left. | [
"6\n1 5 5 1 6 1\n",
"5\n2 4 2 4 4\n",
"5\n6 6 6 6 6\n"
] | [
"3\n5 6 1 \n",
"2\n2 4 \n",
"1\n6 \n"
] | In the first example you should remove two integers $1$, which are in the positions $1$ and $4$. Also you should remove the integer $5$, which is in the position $2$.
In the second example you should remove integer $2$, which is in the position $1$, and two integers $4$, which are in the positions $2$ and $4$.
In the... | 0 | [
{
"input": "6\n1 5 5 1 6 1",
"output": "3\n5 6 1 "
},
{
"input": "5\n2 4 2 4 4",
"output": "2\n2 4 "
},
{
"input": "5\n6 6 6 6 6",
"output": "1\n6 "
},
{
"input": "7\n1 2 3 4 2 2 3",
"output": "4\n1 4 2 3 "
},
{
"input": "9\n100 100 100 99 99 99 100 100 100",
... | 1,681,739,088 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 28 | 93 | 0 | n=int(input())
s=list(map(int,input().split()))[::-1]
g=[]
for i in s:
if i not in g:
g.append(i)
print(len(g))
print(*g[::-1]) | Title: Remove Duplicates
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya has an array $a$ consisting of $n$ integers. He wants to remove duplicate (equal) elements.
Petya wants to leave only the rightmost entry (occurrence) for each element of the array. The relative order of the re... | ```python
n=int(input())
s=list(map(int,input().split()))[::-1]
g=[]
for i in s:
if i not in g:
g.append(i)
print(len(g))
print(*g[::-1])
``` | 3 | |
219 | A | k-String | PROGRAMMING | 1,000 | [
"implementation",
"strings"
] | null | null | A string is called a *k*-string if it can be represented as *k* concatenated copies of some string. For example, the string "aabaabaabaab" is at the same time a 1-string, a 2-string and a 4-string, but it is not a 3-string, a 5-string, or a 6-string and so on. Obviously any string is a 1-string.
You are given a string... | The first input line contains integer *k* (1<=≤<=*k*<=≤<=1000). The second line contains *s*, all characters in *s* are lowercase English letters. The string length *s* satisfies the inequality 1<=≤<=|*s*|<=≤<=1000, where |*s*| is the length of string *s*. | Rearrange the letters in string *s* in such a way that the result is a *k*-string. Print the result on a single output line. If there are multiple solutions, print any of them.
If the solution doesn't exist, print "-1" (without quotes). | [
"2\naazz\n",
"3\nabcabcabz\n"
] | [
"azaz\n",
"-1\n"
] | none | 500 | [
{
"input": "2\naazz",
"output": "azaz"
},
{
"input": "3\nabcabcabz",
"output": "-1"
},
{
"input": "1\na",
"output": "a"
},
{
"input": "2\nabba",
"output": "abab"
},
{
"input": "2\naaab",
"output": "-1"
},
{
"input": "7\nabacaba",
"output": "-1"
}... | 1,634,157,994 | 2,147,483,647 | PyPy 3 | OK | TESTS | 42 | 216 | 102,400 | from collections import Counter
def solve():
k=int(input())
s=list(input())
c=Counter(s)
ans=''
for key,v in c.items():
if v%k:
return -1
ans+=(key)*(v//k)
return ans*k
print(solve()) | Title: k-String
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A string is called a *k*-string if it can be represented as *k* concatenated copies of some string. For example, the string "aabaabaabaab" is at the same time a 1-string, a 2-string and a 4-string, but it is not a 3-string, a ... | ```python
from collections import Counter
def solve():
k=int(input())
s=list(input())
c=Counter(s)
ans=''
for key,v in c.items():
if v%k:
return -1
ans+=(key)*(v//k)
return ans*k
print(solve())
``` | 3 | |
867 | A | Between the Offices | PROGRAMMING | 800 | [
"implementation"
] | null | null | As you may know, MemSQL has American offices in both San Francisco and Seattle. Being a manager in the company, you travel a lot between the two cities, always by plane.
You prefer flying from Seattle to San Francisco than in the other direction, because it's warmer in San Francisco. You are so busy that you don't rem... | The first line of input contains single integer *n* (2<=≤<=*n*<=≤<=100) — the number of days.
The second line contains a string of length *n* consisting of only capital 'S' and 'F' letters. If the *i*-th letter is 'S', then you were in Seattle office on that day. Otherwise you were in San Francisco. The days are given... | Print "YES" if you flew more times from Seattle to San Francisco, and "NO" otherwise.
You can print each letter in any case (upper or lower). | [
"4\nFSSF\n",
"2\nSF\n",
"10\nFFFFFFFFFF\n",
"10\nSSFFSFFSFF\n"
] | [
"NO\n",
"YES\n",
"NO\n",
"YES\n"
] | In the first example you were initially at San Francisco, then flew to Seattle, were there for two days and returned to San Francisco. You made one flight in each direction, so the answer is "NO".
In the second example you just flew from Seattle to San Francisco, so the answer is "YES".
In the third example you staye... | 500 | [
{
"input": "4\nFSSF",
"output": "NO"
},
{
"input": "2\nSF",
"output": "YES"
},
{
"input": "10\nFFFFFFFFFF",
"output": "NO"
},
{
"input": "10\nSSFFSFFSFF",
"output": "YES"
},
{
"input": "20\nSFSFFFFSSFFFFSSSSFSS",
"output": "NO"
},
{
"input": "20\nSSFFF... | 1,666,102,293 | 2,147,483,647 | Python 3 | OK | TESTS | 34 | 46 | 0 | #867A Between the offices
#SSFFSFFSFF
n=int(input())
s=input()
x=0
y=0
previous=s[0]
for current in s[1:]:
if previous=='S' and current=='F':
x+=1
elif previous=='F' and current=='S':
y+=1
previous=current
if x>y:
print("YES")
else:
print("NO") | Title: Between the Offices
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
As you may know, MemSQL has American offices in both San Francisco and Seattle. Being a manager in the company, you travel a lot between the two cities, always by plane.
You prefer flying from Seattle to San Franci... | ```python
#867A Between the offices
#SSFFSFFSFF
n=int(input())
s=input()
x=0
y=0
previous=s[0]
for current in s[1:]:
if previous=='S' and current=='F':
x+=1
elif previous=='F' and current=='S':
y+=1
previous=current
if x>y:
print("YES")
else:
print("NO")
``` | 3 | |
550 | A | Two Substrings | PROGRAMMING | 1,500 | [
"brute force",
"dp",
"greedy",
"implementation",
"strings"
] | null | null | You are given string *s*. Your task is to determine if the given string *s* contains two non-overlapping substrings "AB" and "BA" (the substrings can go in any order). | The only line of input contains a string *s* of length between 1 and 105 consisting of uppercase Latin letters. | Print "YES" (without the quotes), if string *s* contains two non-overlapping substrings "AB" and "BA", and "NO" otherwise. | [
"ABA\n",
"BACFAB\n",
"AXBYBXA\n"
] | [
"NO\n",
"YES\n",
"NO\n"
] | In the first sample test, despite the fact that there are substrings "AB" and "BA", their occurrences overlap, so the answer is "NO".
In the second sample test there are the following occurrences of the substrings: BACFAB.
In the third sample test there is no substring "AB" nor substring "BA". | 1,000 | [
{
"input": "ABA",
"output": "NO"
},
{
"input": "BACFAB",
"output": "YES"
},
{
"input": "AXBYBXA",
"output": "NO"
},
{
"input": "ABABAB",
"output": "YES"
},
{
"input": "BBBBBBBBBB",
"output": "NO"
},
{
"input": "ABBA",
"output": "YES"
},
{
"... | 1,697,987,565 | 2,147,483,647 | PyPy 3 | OK | TESTS | 85 | 92 | 614,400 | s = input()
sAB = s.find("AB")
sBA = s.find("BA")
if sAB != -1 and sBA != -1 and abs(sAB - sBA) > 1:
print("YES")
else:
if "AB" in s and "BA" in s[s.index("AB") + 2:]:
print("YES")
exit()
if "BA" in s and "AB" in s[s.index("BA") + 2:]:
print("YES")
exit()
else:
print("NO")
... | Title: Two Substrings
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given string *s*. Your task is to determine if the given string *s* contains two non-overlapping substrings "AB" and "BA" (the substrings can go in any order).
Input Specification:
The only line of input contain... | ```python
s = input()
sAB = s.find("AB")
sBA = s.find("BA")
if sAB != -1 and sBA != -1 and abs(sAB - sBA) > 1:
print("YES")
else:
if "AB" in s and "BA" in s[s.index("AB") + 2:]:
print("YES")
exit()
if "BA" in s and "AB" in s[s.index("BA") + 2:]:
print("YES")
exit()
else:
print("NO")
... | 3 | |
285 | B | Find Marble | PROGRAMMING | 1,200 | [
"implementation"
] | null | null | Petya and Vasya are playing a game. Petya's got *n* non-transparent glasses, standing in a row. The glasses' positions are indexed with integers from 1 to *n* from left to right. Note that the positions are indexed but the glasses are not.
First Petya puts a marble under the glass in position *s*. Then he performs som... | The first line contains three integers: *n*,<=*s*,<=*t* (1<=≤<=*n*<=≤<=105; 1<=≤<=*s*,<=*t*<=≤<=*n*) — the number of glasses, the ball's initial and final position. The second line contains *n* space-separated integers: *p*1,<=*p*2,<=...,<=*p**n* (1<=≤<=*p**i*<=≤<=*n*) — the shuffling operation parameters. It is guaran... | If the marble can move from position *s* to position *t*, then print on a single line a non-negative integer — the minimum number of shuffling operations, needed to get the marble to position *t*. If it is impossible, print number -1. | [
"4 2 1\n2 3 4 1\n",
"4 3 3\n4 1 3 2\n",
"4 3 4\n1 2 3 4\n",
"3 1 3\n2 1 3\n"
] | [
"3\n",
"0\n",
"-1\n",
"-1\n"
] | none | 1,000 | [
{
"input": "4 2 1\n2 3 4 1",
"output": "3"
},
{
"input": "4 3 3\n4 1 3 2",
"output": "0"
},
{
"input": "4 3 4\n1 2 3 4",
"output": "-1"
},
{
"input": "3 1 3\n2 1 3",
"output": "-1"
},
{
"input": "1 1 1\n1",
"output": "0"
},
{
"input": "10 6 7\n10 7 8 1... | 1,658,487,139 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 33 | 186 | 14,131,200 | import sys
import math
input = sys.stdin.readline
from collections import defaultdict
n, s, t = map(int, input().split())
lst = list(map(int, input().split()))
if s == t:
print(0)
exit()
# for i in range(n):
# if lst[i] == i+1 or lst[lst[i] - 1] == lst[i]:
# print(-1)
# exit()
p = lst[s-1]
c... | Title: Find Marble
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya and Vasya are playing a game. Petya's got *n* non-transparent glasses, standing in a row. The glasses' positions are indexed with integers from 1 to *n* from left to right. Note that the positions are indexed but the ... | ```python
import sys
import math
input = sys.stdin.readline
from collections import defaultdict
n, s, t = map(int, input().split())
lst = list(map(int, input().split()))
if s == t:
print(0)
exit()
# for i in range(n):
# if lst[i] == i+1 or lst[lst[i] - 1] == lst[i]:
# print(-1)
# exit()
p = ... | 3 | |
476 | A | Dreamoon and Stairs | PROGRAMMING | 1,000 | [
"implementation",
"math"
] | null | null | Dreamoon wants to climb up a stair of *n* steps. He can climb 1 or 2 steps at each move. Dreamoon wants the number of moves to be a multiple of an integer *m*.
What is the minimal number of moves making him climb to the top of the stairs that satisfies his condition? | The single line contains two space separated integers *n*, *m* (0<=<<=*n*<=≤<=10000,<=1<=<<=*m*<=≤<=10). | Print a single integer — the minimal number of moves being a multiple of *m*. If there is no way he can climb satisfying condition print <=-<=1 instead. | [
"10 2\n",
"3 5\n"
] | [
"6\n",
"-1\n"
] | For the first sample, Dreamoon could climb in 6 moves with following sequence of steps: {2, 2, 2, 2, 1, 1}.
For the second sample, there are only three valid sequence of steps {2, 1}, {1, 2}, {1, 1, 1} with 2, 2, and 3 steps respectively. All these numbers are not multiples of 5. | 500 | [
{
"input": "10 2",
"output": "6"
},
{
"input": "3 5",
"output": "-1"
},
{
"input": "29 7",
"output": "21"
},
{
"input": "2 2",
"output": "2"
},
{
"input": "1 2",
"output": "-1"
},
{
"input": "10000 2",
"output": "5000"
},
{
"input": "10000 ... | 1,682,145,335 | 2,147,483,647 | Python 3 | OK | TESTS | 35 | 46 | 0 | stairs, multiple = map(int, input().split())
twos = 0
ones = 0
if stairs < multiple:
print(-1)
if stairs % 2 == 0:
twos = stairs // 2
ones = 0
else:
twos = stairs // 2
ones = 1
# check = True
# if (stairs / multiple)
while twos >= 0:
if (twos + ones) % multiple == 0:
... | Title: Dreamoon and Stairs
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Dreamoon wants to climb up a stair of *n* steps. He can climb 1 or 2 steps at each move. Dreamoon wants the number of moves to be a multiple of an integer *m*.
What is the minimal number of moves making him climb ... | ```python
stairs, multiple = map(int, input().split())
twos = 0
ones = 0
if stairs < multiple:
print(-1)
if stairs % 2 == 0:
twos = stairs // 2
ones = 0
else:
twos = stairs // 2
ones = 1
# check = True
# if (stairs / multiple)
while twos >= 0:
if (twos + ones) % multiple ==... | 3 | |
391 | A | Genetic Engineering | PROGRAMMING | 0 | [
"implementation",
"two pointers"
] | null | null | You will receive 3 points for solving this problem.
Manao is designing the genetic code for a new type of algae to efficiently produce fuel. Specifically, Manao is focusing on a stretch of DNA that encodes one protein. The stretch of DNA is represented by a string containing only the characters 'A', 'T', 'G' and 'C'.
... | The input consists of a single line, containing a string *s* of length *n* (1<=≤<=*n*<=≤<=100). Each character of *s* will be from the set {'A', 'T', 'G', 'C'}.
This problem doesn't have subproblems. You will get 3 points for the correct submission. | The program should print on one line a single integer representing the minimum number of 'A', 'T', 'G', 'C' characters that are required to be inserted into the input string in order to make all runs of identical characters have odd length. | [
"GTTAAAG\n",
"AACCAACCAAAAC\n"
] | [
"1\n",
"5\n"
] | In the first example, it is sufficient to insert a single nucleotide of any type between the two 'T's in the sequence to restore the functionality of the protein. | 3 | [
{
"input": "GTTAAAG",
"output": "1"
},
{
"input": "AACCAACCAAAAC",
"output": "5"
},
{
"input": "GTGAATTTCC",
"output": "2"
},
{
"input": "CAGGGGGCCGCCCATGAAAAAAACCCGGCCCCTTGGGAAAACTTGGGTTA",
"output": "7"
},
{
"input": "CCCTTCACCCGGATCCAAATCCCTTAGAAATAATCCCCGACGGC... | 1,561,211,370 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 93 | 0 | tot=1
ans=0
a=input()
l=len(a)
i=1
while i<l+1:
if a[i]==a[i-1]:
tot+=1
else:
if tot%2==0:
ans+=1
tot=1
i+=1
print(ans) | Title: Genetic Engineering
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You will receive 3 points for solving this problem.
Manao is designing the genetic code for a new type of algae to efficiently produce fuel. Specifically, Manao is focusing on a stretch of DNA that encodes one prot... | ```python
tot=1
ans=0
a=input()
l=len(a)
i=1
while i<l+1:
if a[i]==a[i-1]:
tot+=1
else:
if tot%2==0:
ans+=1
tot=1
i+=1
print(ans)
``` | -1 | |
631 | C | Report | PROGRAMMING | 1,700 | [
"data structures",
"sortings"
] | null | null | Each month Blake gets the report containing main economic indicators of the company "Blake Technologies". There are *n* commodities produced by the company. For each of them there is exactly one integer in the final report, that denotes corresponding revenue. Before the report gets to Blake, it passes through the hands... | The first line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=200<=000) — the number of commodities in the report and the number of managers, respectively.
The second line contains *n* integers *a**i* (|*a**i*|<=≤<=109) — the initial report before it gets to the first manager.
Then follow *m* lin... | Print *n* integers — the final report, which will be passed to Blake by manager number *m*. | [
"3 1\n1 2 3\n2 2\n",
"4 2\n1 2 4 3\n2 3\n1 2\n"
] | [
"2 1 3 ",
"2 4 1 3 "
] | In the first sample, the initial report looked like: 1 2 3. After the first manager the first two numbers were transposed: 2 1 3. The report got to Blake in this form.
In the second sample the original report was like this: 1 2 4 3. After the first manager the report changed to: 4 2 1 3. After the second manager the r... | 1,500 | [
{
"input": "3 1\n1 2 3\n2 2",
"output": "2 1 3 "
},
{
"input": "4 2\n1 2 4 3\n2 3\n1 2",
"output": "2 4 1 3 "
},
{
"input": "4 1\n4 3 2 1\n1 4",
"output": "1 2 3 4 "
},
{
"input": "5 1\n1 2 3 4 5\n2 5",
"output": "5 4 3 2 1 "
},
{
"input": "6 2\n3 1 2 6 4 5\n1 6\n... | 1,459,433,197 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 23 | 2,000 | 20,992,000 | a, b = (int(i) for i in input().split())
f = list(map(int,input().split()))
d = []
for i in range(b):
c, e = (int(t) for t in input().split())
while len(d) > 0 and e > d[-1][1]:
d.pop()
d.append([c, e])
c, e = 0, d[0][1]
d.append([0, 0])
g = sorted(f[:e])
for i in range(1,len(d)):
fo... | Title: Report
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Each month Blake gets the report containing main economic indicators of the company "Blake Technologies". There are *n* commodities produced by the company. For each of them there is exactly one integer in the final report, that... | ```python
a, b = (int(i) for i in input().split())
f = list(map(int,input().split()))
d = []
for i in range(b):
c, e = (int(t) for t in input().split())
while len(d) > 0 and e > d[-1][1]:
d.pop()
d.append([c, e])
c, e = 0, d[0][1]
d.append([0, 0])
g = sorted(f[:e])
for i in range(1,len(d)... | 0 | |
854 | A | Fraction | PROGRAMMING | 800 | [
"brute force",
"constructive algorithms",
"math"
] | null | null | Petya is a big fan of mathematics, especially its part related to fractions. Recently he learned that a fraction is called proper iff its numerator is smaller than its denominator (*a*<=<<=*b*) and that the fraction is called irreducible if its numerator and its denominator are coprime (they do not have positive co... | In the only line of input there is an integer *n* (3<=≤<=*n*<=≤<=1000), the sum of numerator and denominator of the fraction. | Output two space-separated positive integers *a* and *b*, numerator and denominator of the maximum possible proper irreducible fraction satisfying the given sum. | [
"3\n",
"4\n",
"12\n"
] | [
"1 2\n",
"1 3\n",
"5 7\n"
] | none | 500 | [
{
"input": "3",
"output": "1 2"
},
{
"input": "4",
"output": "1 3"
},
{
"input": "12",
"output": "5 7"
},
{
"input": "34",
"output": "15 19"
},
{
"input": "13",
"output": "6 7"
},
{
"input": "11",
"output": "5 6"
},
{
"input": "24",
"ou... | 1,544,249,143 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 5 | 124 | 0 | n = int(input())
m = 0
l = []
d = []
for i in range(1, n):
for j in range(1, n):
x = 0
if i + j == n and i < j and i / j > m:
for a in range(2, i//2+1):
if i % a == 0:
d.append(a)
for a in d:
if j % a == 0:
x = 1
if x == 1:
continue
else:
m = i / j
l = [i... | Title: Fraction
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya is a big fan of mathematics, especially its part related to fractions. Recently he learned that a fraction is called proper iff its numerator is smaller than its denominator (*a*<=<<=*b*) and that the fraction is cal... | ```python
n = int(input())
m = 0
l = []
d = []
for i in range(1, n):
for j in range(1, n):
x = 0
if i + j == n and i < j and i / j > m:
for a in range(2, i//2+1):
if i % a == 0:
d.append(a)
for a in d:
if j % a == 0:
x = 1
if x == 1:
continue
else:
m = i / j
... | 0 | |
757 | A | Gotta Catch Em' All! | PROGRAMMING | 1,000 | [
"implementation"
] | null | null | Bash wants to become a Pokemon master one day. Although he liked a lot of Pokemon, he has always been fascinated by Bulbasaur the most. Soon, things started getting serious and his fascination turned into an obsession. Since he is too young to go out and catch Bulbasaur, he came up with his own way of catching a Bulbas... | Input contains a single line containing a string *s* (1<=<=≤<=<=|*s*|<=<=≤<=<=105) — the text on the front page of the newspaper without spaces and punctuation marks. |*s*| is the length of the string *s*.
The string *s* contains lowercase and uppercase English letters, i.e. . | Output a single integer, the answer to the problem. | [
"Bulbbasaur\n",
"F\n",
"aBddulbasaurrgndgbualdBdsagaurrgndbb\n"
] | [
"1\n",
"0\n",
"2\n"
] | In the first case, you could pick: Bulbbasaur.
In the second case, there is no way to pick even a single Bulbasaur.
In the third case, you can rearrange the string to BulbasaurBulbasauraddrgndgddgargndbb to get two words "Bulbasaur". | 500 | [
{
"input": "Bulbbasaur",
"output": "1"
},
{
"input": "F",
"output": "0"
},
{
"input": "aBddulbasaurrgndgbualdBdsagaurrgndbb",
"output": "2"
},
{
"input": "BBBBBBBBBBbbbbbbbbbbuuuuuuuuuullllllllllssssssssssaaaaaaaaaarrrrrrrrrr",
"output": "5"
},
{
"input": "BBBBBBB... | 1,484,340,511 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 12 | 1,000 | 4,812,800 | x=input()
s=x
w=0
d=set('Bulbasaur')
for i in range(len(s)):
if 'B' in s and 'u' in s and 'l' in s and 'b' in s and 'a' in s and 's' in s and 'a' in s and 'u' in s and 'r' in s:
w+=1
s=s.replace('B','',1)
s=s.replace('u','',1)
s=s.replace('l','',1)
s=s.replace('b','',1)
... | Title: Gotta Catch Em' All!
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bash wants to become a Pokemon master one day. Although he liked a lot of Pokemon, he has always been fascinated by Bulbasaur the most. Soon, things started getting serious and his fascination turned into an obsess... | ```python
x=input()
s=x
w=0
d=set('Bulbasaur')
for i in range(len(s)):
if 'B' in s and 'u' in s and 'l' in s and 'b' in s and 'a' in s and 's' in s and 'a' in s and 'u' in s and 'r' in s:
w+=1
s=s.replace('B','',1)
s=s.replace('u','',1)
s=s.replace('l','',1)
s=s.replace('b'... | 0 | |
387 | B | George and Round | PROGRAMMING | 1,200 | [
"brute force",
"greedy",
"two pointers"
] | null | null | George decided to prepare a Codesecrof round, so he has prepared *m* problems for the round. Let's number the problems with integers 1 through *m*. George estimates the *i*-th problem's complexity by integer *b**i*.
To make the round good, he needs to put at least *n* problems there. Besides, he needs to have at least... | The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=3000) — the minimal number of problems in a good round and the number of problems George's prepared. The second line contains space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a*1<=<<=*a*2<=<<=...<=<<=*a**n*<=≤<=106) — the requirem... | Print a single integer — the answer to the problem. | [
"3 5\n1 2 3\n1 2 2 3 3\n",
"3 5\n1 2 3\n1 1 1 1 1\n",
"3 1\n2 3 4\n1\n"
] | [
"0\n",
"2\n",
"3\n"
] | In the first sample the set of the prepared problems meets the requirements for a good round.
In the second sample, it is enough to come up with and prepare two problems with complexities 2 and 3 to get a good round.
In the third sample it is very easy to get a good round if come up with and prepare extra problems wi... | 1,000 | [
{
"input": "3 5\n1 2 3\n1 2 2 3 3",
"output": "0"
},
{
"input": "3 5\n1 2 3\n1 1 1 1 1",
"output": "2"
},
{
"input": "3 1\n2 3 4\n1",
"output": "3"
},
{
"input": "29 100\n20 32 41 67 72 155 331 382 399 412 465 470 484 511 515 529 616 637 679 715 733 763 826 843 862 903 925 97... | 1,578,445,596 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 3 | 93 | 307,200 | n, m = map(int, input().split())
a = list(map(int, input().split()))
b = list(map(int, input().split()))
c = [0]*(3000 + 1)
count = 0
dif = m - n
for i in b:
c[i] += 1
for i in a:
if c[i] == 0:
count += 1
if dif >= 0 and count == 0:
print(0)
else:
if abs(dif) > count:
... | Title: George and Round
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
George decided to prepare a Codesecrof round, so he has prepared *m* problems for the round. Let's number the problems with integers 1 through *m*. George estimates the *i*-th problem's complexity by integer *b**i*.
T... | ```python
n, m = map(int, input().split())
a = list(map(int, input().split()))
b = list(map(int, input().split()))
c = [0]*(3000 + 1)
count = 0
dif = m - n
for i in b:
c[i] += 1
for i in a:
if c[i] == 0:
count += 1
if dif >= 0 and count == 0:
print(0)
else:
if abs(dif) > count:... | -1 | |
834 | B | The Festive Evening | PROGRAMMING | 1,100 | [
"data structures",
"implementation"
] | null | null | It's the end of July – the time when a festive evening is held at Jelly Castle! Guests from all over the kingdom gather here to discuss new trends in the world of confectionery. Yet some of the things discussed here are not supposed to be disclosed to the general public: the information can cause discord in the kingdom... | Two integers are given in the first string: the number of guests *n* and the number of guards *k* (1<=≤<=*n*<=≤<=106, 1<=≤<=*k*<=≤<=26).
In the second string, *n* uppercase English letters *s*1*s*2... *s**n* are given, where *s**i* is the entrance used by the *i*-th guest. | Output «YES» if at least one door was unguarded during some time, and «NO» otherwise.
You can output each letter in arbitrary case (upper or lower). | [
"5 1\nAABBB\n",
"5 1\nABABB\n"
] | [
"NO\n",
"YES\n"
] | In the first sample case, the door A is opened right before the first guest's arrival and closed when the second guest enters the castle. The door B is opened right before the arrival of the third guest, and closed after the fifth one arrives. One guard can handle both doors, as the first one is closed before the secon... | 1,000 | [
{
"input": "5 1\nAABBB",
"output": "NO"
},
{
"input": "5 1\nABABB",
"output": "YES"
},
{
"input": "26 1\nABCDEFGHIJKLMNOPQRSTUVWXYZ",
"output": "NO"
},
{
"input": "27 1\nABCDEFGHIJKLMNOPQRSTUVWXYZA",
"output": "YES"
},
{
"input": "5 2\nABACA",
"output": "NO"
... | 1,501,431,316 | 6,016 | Python 3 | WRONG_ANSWER | PRETESTS | 0 | 31 | 4,608,000 | n,k=map(int,input().split())
s=input()
gate=[False]*26
count=[0]*26
for i in range(n):
index=ord(s[i])-65
count[index]+=1
guard=0
exc=False
print(count)
for i in range(n):
index=ord(s[i])-65
if gate[index]:
count[index]-=1
if count[index]==0:
guard=guard-1
else:
count[index]-=1
gate[in... | Title: The Festive Evening
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
It's the end of July – the time when a festive evening is held at Jelly Castle! Guests from all over the kingdom gather here to discuss new trends in the world of confectionery. Yet some of the things discussed here... | ```python
n,k=map(int,input().split())
s=input()
gate=[False]*26
count=[0]*26
for i in range(n):
index=ord(s[i])-65
count[index]+=1
guard=0
exc=False
print(count)
for i in range(n):
index=ord(s[i])-65
if gate[index]:
count[index]-=1
if count[index]==0:
guard=guard-1
else:
count[index]-=1
... | 0 | |
4 | A | Watermelon | PROGRAMMING | 800 | [
"brute force",
"math"
] | A. Watermelon | 1 | 64 | One hot summer day Pete and his friend Billy decided to buy a watermelon. They chose the biggest and the ripest one, in their opinion. After that the watermelon was weighed, and the scales showed *w* kilos. They rushed home, dying of thirst, and decided to divide the berry, however they faced a hard problem.
Pete and ... | The first (and the only) input line contains integer number *w* (1<=≤<=*w*<=≤<=100) — the weight of the watermelon bought by the boys. | Print YES, if the boys can divide the watermelon into two parts, each of them weighing even number of kilos; and NO in the opposite case. | [
"8\n"
] | [
"YES\n"
] | For example, the boys can divide the watermelon into two parts of 2 and 6 kilos respectively (another variant — two parts of 4 and 4 kilos). | 0 | [
{
"input": "8",
"output": "YES"
},
{
"input": "5",
"output": "NO"
},
{
"input": "4",
"output": "YES"
},
{
"input": "3",
"output": "NO"
},
{
"input": "2",
"output": "NO"
},
{
"input": "1",
"output": "NO"
},
{
"input": "7",
"output": "NO"... | 1,688,627,273 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 4 | 60 | 0 | input=int(input())
if input%2==0:
print("YES")
elif input==0:
print("NO")
else:
print("NO") | Title: Watermelon
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
One hot summer day Pete and his friend Billy decided to buy a watermelon. They chose the biggest and the ripest one, in their opinion. After that the watermelon was weighed, and the scales showed *w* kilos. They rushed home, dyin... | ```python
input=int(input())
if input%2==0:
print("YES")
elif input==0:
print("NO")
else:
print("NO")
``` | 0 |
898 | C | Phone Numbers | PROGRAMMING | 1,400 | [
"implementation",
"strings"
] | null | null | Vasya has several phone books, in which he recorded the telephone numbers of his friends. Each of his friends can have one or several phone numbers.
Vasya decided to organize information about the phone numbers of friends. You will be given *n* strings — all entries from Vasya's phone books. Each entry starts with a f... | First line contains the integer *n* (1<=≤<=*n*<=≤<=20) — number of entries in Vasya's phone books.
The following *n* lines are followed by descriptions of the records in the format described in statement. Names of Vasya's friends are non-empty strings whose length does not exceed 10. They consists only of lowercase E... | Print out the ordered information about the phone numbers of Vasya's friends. First output *m* — number of friends that are found in Vasya's phone books.
The following *m* lines must contain entries in the following format "name number_of_phone_numbers phone_numbers". Phone numbers should be separated by a space. Each... | [
"2\nivan 1 00123\nmasha 1 00123\n",
"3\nkarl 2 612 12\npetr 1 12\nkatya 1 612\n",
"4\nivan 3 123 123 456\nivan 2 456 456\nivan 8 789 3 23 6 56 9 89 2\ndasha 2 23 789\n"
] | [
"2\nmasha 1 00123 \nivan 1 00123 \n",
"3\nkatya 1 612 \npetr 1 12 \nkarl 1 612 \n",
"2\ndasha 2 23 789 \nivan 4 789 123 2 456 \n"
] | none | 1,500 | [
{
"input": "2\nivan 1 00123\nmasha 1 00123",
"output": "2\nmasha 1 00123 \nivan 1 00123 "
},
{
"input": "3\nkarl 2 612 12\npetr 1 12\nkatya 1 612",
"output": "3\nkatya 1 612 \npetr 1 12 \nkarl 1 612 "
},
{
"input": "4\nivan 3 123 123 456\nivan 2 456 456\nivan 8 789 3 23 6 56 9 89 2\ndash... | 1,666,451,508 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 59 | 62 | 0 | """ Prositka
10.10.2022"""
n=int(input())
d=dict()
for i in range(n):
a=input().split()
if a[0] not in d:
d[a[0]]=[]
for j in range(2, len(a)):
a[j]=a[j][::-1]
d[a[0]]+=a[2:]
print(len(d))
for x in d:
a=d[x]
a.sort(reverse=True)
b=[a[0]]
for i in range(1... | Title: Phone Numbers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya has several phone books, in which he recorded the telephone numbers of his friends. Each of his friends can have one or several phone numbers.
Vasya decided to organize information about the phone numbers of friend... | ```python
""" Prositka
10.10.2022"""
n=int(input())
d=dict()
for i in range(n):
a=input().split()
if a[0] not in d:
d[a[0]]=[]
for j in range(2, len(a)):
a[j]=a[j][::-1]
d[a[0]]+=a[2:]
print(len(d))
for x in d:
a=d[x]
a.sort(reverse=True)
b=[a[0]]
for i ... | 3 | |
851 | A | Arpa and a research in Mexican wave | PROGRAMMING | 800 | [
"implementation",
"math"
] | null | null | Arpa is researching the Mexican wave.
There are *n* spectators in the stadium, labeled from 1 to *n*. They start the Mexican wave at time 0.
- At time 1, the first spectator stands. - At time 2, the second spectator stands. - ... - At time *k*, the *k*-th spectator stands. - At time *k*<=+<=1, the (*k*<=+<=1)-t... | The first line contains three integers *n*, *k*, *t* (1<=≤<=*n*<=≤<=109, 1<=≤<=*k*<=≤<=*n*, 1<=≤<=*t*<=<<=*n*<=+<=*k*). | Print single integer: how many spectators are standing at time *t*. | [
"10 5 3\n",
"10 5 7\n",
"10 5 12\n"
] | [
"3\n",
"5\n",
"3\n"
] | In the following a sitting spectator is represented as -, a standing spectator is represented as ^.
- At *t* = 0 ---------- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/4d97e684117250a9afe9be022ab8a63653dd15aa.png" style="max-width: 100.0%;max-height: 100.0%;"/> number of standing spe... | 500 | [
{
"input": "10 5 3",
"output": "3"
},
{
"input": "10 5 7",
"output": "5"
},
{
"input": "10 5 12",
"output": "3"
},
{
"input": "840585600 770678331 788528791",
"output": "770678331"
},
{
"input": "25462281 23343504 8024619",
"output": "8024619"
},
{
"in... | 1,504,536,077 | 377 | Python 3 | OK | TESTS | 166 | 78 | 0 | n,t,k = map(int,input().split())
if(t>k):
print(k)
elif(k>n):
print(t-(k-n))
else:
print(t) | Title: Arpa and a research in Mexican wave
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Arpa is researching the Mexican wave.
There are *n* spectators in the stadium, labeled from 1 to *n*. They start the Mexican wave at time 0.
- At time 1, the first spectator stands. - At time 2,... | ```python
n,t,k = map(int,input().split())
if(t>k):
print(k)
elif(k>n):
print(t-(k-n))
else:
print(t)
``` | 3 | |
20 | B | Equation | PROGRAMMING | 2,000 | [
"math"
] | B. Equation | 1 | 256 | You are given an equation:
Your task is to find the number of distinct roots of the equation and print all of them in ascending order. | The first line contains three integer numbers *A*,<=*B* and *C* (<=-<=105<=≤<=*A*,<=*B*,<=*C*<=≤<=105). Any coefficient may be equal to 0. | In case of infinite root count print the only integer -1. In case of no roots print the only integer 0. In other cases print the number of root on the first line and the roots on the following lines in the ascending order. Print roots with at least 5 digits after the decimal point. | [
"1 -5 6\n"
] | [
"2\n2.0000000000\n3.0000000000"
] | none | 1,000 | [
{
"input": "1 -5 6",
"output": "2\n2.0000000000\n3.0000000000"
},
{
"input": "1 1 1",
"output": "0"
},
{
"input": "1 2 1",
"output": "1\n-1.0000000000"
},
{
"input": "0 0 0",
"output": "-1"
},
{
"input": "0 -2 1",
"output": "1\n0.5000000000"
},
{
"inpu... | 1,666,677,856 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 31 | 0 | import random as r
######.....FUNCTION TO RETURN WARMER OR COLDER.....######
import sys
import time
counter=1
def find(z,n):
global counter
global Prev_diff
counter+=1
if n==z: return 'BINGO'
elif abs(z-n)>=abs(Prev_diff):
Prev_diff=abs(z - n)
... | Title: Equation
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
You are given an equation:
Your task is to find the number of distinct roots of the equation and print all of them in ascending order.
Input Specification:
The first line contains three integer numbers *A*,<=*B* and *C* (<=-<=1... | ```python
import random as r
######.....FUNCTION TO RETURN WARMER OR COLDER.....######
import sys
import time
counter=1
def find(z,n):
global counter
global Prev_diff
counter+=1
if n==z: return 'BINGO'
elif abs(z-n)>=abs(Prev_diff):
Prev_diff=abs(z - n)
... | 0 |
16 | C | Monitor | PROGRAMMING | 1,800 | [
"binary search",
"number theory"
] | C. Monitor | 0 | 64 | Reca company makes monitors, the most popular of their models is AB999 with the screen size *a*<=×<=*b* centimeters. Because of some production peculiarities a screen parameters are integer numbers. Recently the screen sides ratio *x*:<=*y* became popular with users. That's why the company wants to reduce monitor AB999... | The first line of the input contains 4 integers — *a*, *b*, *x* and *y* (1<=≤<=*a*,<=*b*,<=*x*,<=*y*<=≤<=2·109). | If the answer exists, output 2 positive integers — screen parameters of the reduced size model. Output 0 0 otherwise. | [
"800 600 4 3\n",
"1920 1200 16 9\n",
"1 1 1 2\n"
] | [
"800 600\n",
"1920 1080\n",
"0 0\n"
] | none | 0 | [
{
"input": "800 600 4 3",
"output": "800 600"
},
{
"input": "1920 1200 16 9",
"output": "1920 1080"
},
{
"input": "1 1 1 2",
"output": "0 0"
},
{
"input": "1002105126 227379125 179460772 1295256518",
"output": "0 0"
},
{
"input": "625166755 843062051 1463070160 19... | 1,503,738,735 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 6 | 77 | 0 | a, b, x, y = map(int, input().split(' '))
if a < x or b < y:
i = 2
while i * i <= y:
if x % i == 0 and y % i == 0:
if x // i <= a and y // i <= b:
print(x // i, y // i, sep=' ')
exit()
i += 1
l = 0
r = 1e18
while r - l > 1:
mid = (r + l... | Title: Monitor
Time Limit: 0 seconds
Memory Limit: 64 megabytes
Problem Description:
Reca company makes monitors, the most popular of their models is AB999 with the screen size *a*<=×<=*b* centimeters. Because of some production peculiarities a screen parameters are integer numbers. Recently the screen sides ratio *... | ```python
a, b, x, y = map(int, input().split(' '))
if a < x or b < y:
i = 2
while i * i <= y:
if x % i == 0 and y % i == 0:
if x // i <= a and y // i <= b:
print(x // i, y // i, sep=' ')
exit()
i += 1
l = 0
r = 1e18
while r - l > 1:
mi... | 0 |
975 | A | Aramic script | PROGRAMMING | 900 | [
"implementation",
"strings"
] | null | null | In Aramic language words can only represent objects.
Words in Aramic have special properties:
- A word is a root if it does not contain the same letter more than once. - A root and all its permutations represent the same object. - The root $x$ of a word $y$ is the word that contains all letters that appear in $y$... | The first line contains one integer $n$ ($1 \leq n \leq 10^3$) — the number of words in the script.
The second line contains $n$ words $s_1, s_2, \ldots, s_n$ — the script itself. The length of each string does not exceed $10^3$.
It is guaranteed that all characters of the strings are small latin letters. | Output one integer — the number of different objects mentioned in the given ancient Aramic script. | [
"5\na aa aaa ab abb\n",
"3\namer arem mrea\n"
] | [
"2",
"1"
] | In the first test, there are two objects mentioned. The roots that represent them are "a","ab".
In the second test, there is only one object, its root is "amer", the other strings are just permutations of "amer". | 500 | [
{
"input": "5\na aa aaa ab abb",
"output": "2"
},
{
"input": "3\namer arem mrea",
"output": "1"
},
{
"input": "10\nbda bbb cda dca dda dcb bcd dcb ada ddd",
"output": "6"
},
{
"input": "2\nfhjlqs aceginpr",
"output": "2"
},
{
"input": "2\nbcdfghimn efghijlmo",
... | 1,697,275,525 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 30 | 0 | def solve():
size = int(input())
words = input().split()
d = {}
for word in word:
x = tuple(sorted(set))
d[x] = d.get(tuple(sorted(set)), 0) + 1
print(len(d.values()))
if __name__ == "__main__":
solve() | Title: Aramic script
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In Aramic language words can only represent objects.
Words in Aramic have special properties:
- A word is a root if it does not contain the same letter more than once. - A root and all its permutations represent the ... | ```python
def solve():
size = int(input())
words = input().split()
d = {}
for word in word:
x = tuple(sorted(set))
d[x] = d.get(tuple(sorted(set)), 0) + 1
print(len(d.values()))
if __name__ == "__main__":
solve()
``` | -1 | |
595 | A | Vitaly and Night | PROGRAMMING | 800 | [
"constructive algorithms",
"implementation"
] | null | null | One day Vitaly was going home late at night and wondering: how many people aren't sleeping at that moment? To estimate, Vitaly decided to look which windows are lit in the house he was passing by at that moment.
Vitaly sees a building of *n* floors and 2·*m* windows on each floor. On each floor there are *m* flats num... | The first line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the number of floors in the house and the number of flats on each floor respectively.
Next *n* lines describe the floors from top to bottom and contain 2·*m* characters each. If the *i*-th window of the given floor has lights on,... | Print a single integer — the number of flats that have lights on in at least one window, that is, the flats where, according to Vitaly, people aren't sleeping. | [
"2 2\n0 0 0 1\n1 0 1 1\n",
"1 3\n1 1 0 1 0 0\n"
] | [
"3\n",
"2\n"
] | In the first test case the house has two floors, two flats on each floor. That is, in total there are 4 flats. The light isn't on only on the second floor in the left flat. That is, in both rooms of the flat the light is off.
In the second test case the house has one floor and the first floor has three flats. The ligh... | 500 | [
{
"input": "2 2\n0 0 0 1\n1 0 1 1",
"output": "3"
},
{
"input": "1 3\n1 1 0 1 0 0",
"output": "2"
},
{
"input": "3 3\n1 1 1 1 1 1\n1 1 0 1 1 0\n1 0 0 0 1 1",
"output": "8"
},
{
"input": "1 5\n1 0 1 1 1 0 1 1 1 1",
"output": "5"
},
{
"input": "1 100\n1 1 1 1 1 1 1 ... | 1,447,153,502 | 2,147,483,647 | Python 3 | OK | TESTS | 36 | 62 | 204,800 | data=input().strip().split()
mas=[]
col=0
for i in range(int(data[0])):
mas.append(input().strip().split())
for j in range(1,len(mas[i]),2):
if mas[i][j]=="1" or mas[i][j-1]=="1":
col+=1
print(col) | Title: Vitaly and Night
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day Vitaly was going home late at night and wondering: how many people aren't sleeping at that moment? To estimate, Vitaly decided to look which windows are lit in the house he was passing by at that moment.
Vital... | ```python
data=input().strip().split()
mas=[]
col=0
for i in range(int(data[0])):
mas.append(input().strip().split())
for j in range(1,len(mas[i]),2):
if mas[i][j]=="1" or mas[i][j-1]=="1":
col+=1
print(col)
``` | 3 | |
318 | A | Even Odds | PROGRAMMING | 900 | [
"math"
] | null | null | Being a nonconformist, Volodya is displeased with the current state of things, particularly with the order of natural numbers (natural number is positive integer number). He is determined to rearrange them. But there are too many natural numbers, so Volodya decided to start with the first *n*. He writes down the follow... | The only line of input contains integers *n* and *k* (1<=≤<=*k*<=≤<=*n*<=≤<=1012).
Please, do not use the %lld specifier to read or write 64-bit integers in C++. It is preferred to use the cin, cout streams or the %I64d specifier. | Print the number that will stand at the position number *k* after Volodya's manipulations. | [
"10 3\n",
"7 7\n"
] | [
"5",
"6"
] | In the first sample Volodya's sequence will look like this: {1, 3, 5, 7, 9, 2, 4, 6, 8, 10}. The third place in the sequence is therefore occupied by the number 5. | 500 | [
{
"input": "10 3",
"output": "5"
},
{
"input": "7 7",
"output": "6"
},
{
"input": "7 1",
"output": "1"
},
{
"input": "7 2",
"output": "3"
},
{
"input": "8 5",
"output": "2"
},
{
"input": "8 3",
"output": "5"
},
{
"input": "8 4",
"output... | 1,692,940,675 | 2,147,483,647 | Python 3 | OK | TESTS | 25 | 92 | 0 | from sys import stdin
def main():
n, k = [ int(x) for x in stdin.
readline().split(" ")]
miti= n- n//2
if ( k<=miti):
print(2*(k-1)+1)
else:
print(2*(k-miti))
main()
| Title: Even Odds
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Being a nonconformist, Volodya is displeased with the current state of things, particularly with the order of natural numbers (natural number is positive integer number). He is determined to rearrange them. But there are too ... | ```python
from sys import stdin
def main():
n, k = [ int(x) for x in stdin.
readline().split(" ")]
miti= n- n//2
if ( k<=miti):
print(2*(k-1)+1)
else:
print(2*(k-miti))
main()
``` | 3 | |
129 | A | Cookies | PROGRAMMING | 900 | [
"implementation"
] | null | null | Olga came to visit the twins Anna and Maria and saw that they have many cookies. The cookies are distributed into bags. As there are many cookies, Olga decided that it's no big deal if she steals a bag. However, she doesn't want the sisters to quarrel because of nothing when they divide the cookies. That's why Olga wan... | The first line contains the only integer *n* (1<=≤<=*n*<=≤<=100) — the number of cookie bags Anna and Maria have. The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=100) — the number of cookies in the *i*-th bag. | Print in the only line the only number — the sought number of ways. If there are no such ways print 0. | [
"1\n1\n",
"10\n1 2 2 3 4 4 4 2 2 2\n",
"11\n2 2 2 2 2 2 2 2 2 2 99\n"
] | [
"1\n",
"8\n",
"1\n"
] | In the first sample Olga should take the only bag so that the twins ended up with the even number of cookies.
In the second sample Olga can take any of five bags with two cookies or any of three bags with four cookies — 5 + 3 = 8 ways in total.
In the third sample, no matter which bag with two cookies Olga chooses, t... | 500 | [
{
"input": "1\n1",
"output": "1"
},
{
"input": "10\n1 2 2 3 4 4 4 2 2 2",
"output": "8"
},
{
"input": "11\n2 2 2 2 2 2 2 2 2 2 99",
"output": "1"
},
{
"input": "2\n1 1",
"output": "0"
},
{
"input": "2\n2 2",
"output": "2"
},
{
"input": "2\n1 2",
"o... | 1,560,803,973 | 2,147,483,647 | Python 3 | OK | TESTS | 52 | 248 | 0 | n=int(input())
a=list(map(int,input().split()))
c=0
for i in range(len(a)):
if sum(a)-a[i]&1==0:
c+=1
print(c) | Title: Cookies
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Olga came to visit the twins Anna and Maria and saw that they have many cookies. The cookies are distributed into bags. As there are many cookies, Olga decided that it's no big deal if she steals a bag. However, she doesn't wan... | ```python
n=int(input())
a=list(map(int,input().split()))
c=0
for i in range(len(a)):
if sum(a)-a[i]&1==0:
c+=1
print(c)
``` | 3 | |
459 | E | Pashmak and Graph | PROGRAMMING | 1,900 | [
"dp",
"sortings"
] | null | null | Pashmak's homework is a problem about graphs. Although he always tries to do his homework completely, he can't solve this problem. As you know, he's really weak at graph theory; so try to help him in solving the problem.
You are given a weighted directed graph with *n* vertices and *m* edges. You need to find a path (... | The first line contains two integers *n*, *m* (2<=≤<=*n*<=≤<=3·105; 1<=≤<=*m*<=≤<=*min*(*n*·(*n*<=-<=1),<=3·105)). Then, *m* lines follows. The *i*-th line contains three space separated integers: *u**i*, *v**i*, *w**i* (1<=≤<=*u**i*,<=*v**i*<=≤<=*n*; 1<=≤<=*w**i*<=≤<=105) which indicates that there's a directed edge w... | Print a single integer — the answer to the problem. | [
"3 3\n1 2 1\n2 3 1\n3 1 1\n",
"3 3\n1 2 1\n2 3 2\n3 1 3\n",
"6 7\n1 2 1\n3 2 5\n2 4 2\n2 5 2\n2 6 9\n5 4 3\n4 3 4\n"
] | [
"1\n",
"3\n",
"6\n"
] | In the first sample the maximum trail can be any of this trails: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/1534088dd4d998a9bcc7e17dba96f7c213c54fc6.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
In the second sample the maximum trail is <img align="middle" class="tex-formula" ... | 3,000 | [
{
"input": "3 3\n1 2 1\n2 3 1\n3 1 1",
"output": "1"
},
{
"input": "3 3\n1 2 1\n2 3 2\n3 1 3",
"output": "3"
},
{
"input": "6 7\n1 2 1\n3 2 5\n2 4 2\n2 5 2\n2 6 9\n5 4 3\n4 3 4",
"output": "6"
},
{
"input": "2 2\n1 2 1\n2 1 2",
"output": "2"
},
{
"input": "4 3\n1 ... | 1,669,461,117 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 46 | 0 | [n, m] = list(map(int, input().split()))
graph = [[] for i in range(m + 1)]
def minDistance(graph, dist, src, sptSet, pre, n):
minim = 1e7
min_index = src
for v in range(n):
if dist[v] != minim and sptSet[v] == False:
sptSet[v] = True
min_index = v
return m... | Title: Pashmak and Graph
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Pashmak's homework is a problem about graphs. Although he always tries to do his homework completely, he can't solve this problem. As you know, he's really weak at graph theory; so try to help him in solving the probl... | ```python
[n, m] = list(map(int, input().split()))
graph = [[] for i in range(m + 1)]
def minDistance(graph, dist, src, sptSet, pre, n):
minim = 1e7
min_index = src
for v in range(n):
if dist[v] != minim and sptSet[v] == False:
sptSet[v] = True
min_index = v
... | 0 | |
630 | A | Again Twenty Five! | PROGRAMMING | 800 | [
"number theory"
] | null | null | The HR manager was disappointed again. The last applicant failed the interview the same way as 24 previous ones. "Do I give such a hard task?" — the HR manager thought. "Just raise number 5 to the power of *n* and get last two digits of the number. Yes, of course, *n* can be rather big, and one cannot find the power us... | The only line of the input contains a single integer *n* (2<=≤<=*n*<=≤<=2·1018) — the power in which you need to raise number 5. | Output the last two digits of 5*n* without spaces between them. | [
"2\n"
] | [
"25"
] | none | 0 | [
{
"input": "2",
"output": "25"
},
{
"input": "7",
"output": "25"
},
{
"input": "1000000000000000000",
"output": "25"
},
{
"input": "2000000000000000000",
"output": "25"
},
{
"input": "987654321012345678",
"output": "25"
}
] | 1,688,629,586 | 2,147,483,647 | Python 3 | OK | TESTS | 5 | 31 | 0 | n = int(input())
if n % 4 == 0:
last_two_digits = 25
else:
last_two_digits = pow(5, n % 4)
last_two_digits = last_two_digits % 100
print(last_two_digits)
| Title: Again Twenty Five!
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The HR manager was disappointed again. The last applicant failed the interview the same way as 24 previous ones. "Do I give such a hard task?" — the HR manager thought. "Just raise number 5 to the power of *n* and ge... | ```python
n = int(input())
if n % 4 == 0:
last_two_digits = 25
else:
last_two_digits = pow(5, n % 4)
last_two_digits = last_two_digits % 100
print(last_two_digits)
``` | 3 | |
260 | A | Adding Digits | PROGRAMMING | 1,400 | [
"implementation",
"math"
] | null | null | Vasya has got two number: *a* and *b*. However, Vasya finds number *a* too short. So he decided to repeat the operation of lengthening number *a* *n* times.
One operation of lengthening a number means adding exactly one digit to the number (in the decimal notation) to the right provided that the resulting number is di... | The first line contains three integers: *a*,<=*b*,<=*n* (1<=≤<=*a*,<=*b*,<=*n*<=≤<=105). | In a single line print the integer without leading zeros, which Vasya can get when he applies the lengthening operations to number *a* *n* times. If no such number exists, then print number -1. If there are multiple possible answers, print any of them. | [
"5 4 5\n",
"12 11 1\n",
"260 150 10\n"
] | [
"524848\n",
"121\n",
"-1\n"
] | none | 500 | [
{
"input": "5 4 5",
"output": "524848"
},
{
"input": "12 11 1",
"output": "121"
},
{
"input": "260 150 10",
"output": "-1"
},
{
"input": "78843 5684 42717",
"output": "-1"
},
{
"input": "93248 91435 1133",
"output": "-1"
},
{
"input": "100000 10 64479"... | 1,603,789,459 | 2,147,483,647 | Python 3 | OK | TESTS | 25 | 108 | 204,800 | a,b,n=map(int,input().split())
c=str(a)
for (i) in range(10):
if int(c+str(i))%b==0:
c=c+str(i)
print(c + "0" * (n - 1))
exit()
print(-1)
| Title: Adding Digits
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya has got two number: *a* and *b*. However, Vasya finds number *a* too short. So he decided to repeat the operation of lengthening number *a* *n* times.
One operation of lengthening a number means adding exactly one ... | ```python
a,b,n=map(int,input().split())
c=str(a)
for (i) in range(10):
if int(c+str(i))%b==0:
c=c+str(i)
print(c + "0" * (n - 1))
exit()
print(-1)
``` | 3 | |
137 | B | Permutation | PROGRAMMING | 1,000 | [
"greedy"
] | null | null | "Hey, it's homework time" — thought Polycarpus and of course he started with his favourite subject, IT. Polycarpus managed to solve all tasks but for the last one in 20 minutes. However, as he failed to solve the last task after some considerable time, the boy asked you to help him.
The sequence of *n* integers is cal... | The first line of the input data contains an integer *n* (1<=≤<=*n*<=≤<=5000) which represents how many numbers are in the sequence. The second line contains a sequence of integers *a**i* (1<=≤<=*a**i*<=≤<=5000,<=1<=≤<=*i*<=≤<=*n*). | Print the only number — the minimum number of changes needed to get the permutation. | [
"3\n3 1 2\n",
"2\n2 2\n",
"5\n5 3 3 3 1\n"
] | [
"0\n",
"1\n",
"2\n"
] | The first sample contains the permutation, which is why no replacements are required.
In the second sample it is enough to replace the first element with the number 1 and that will make the sequence the needed permutation.
In the third sample we can replace the second element with number 4 and the fourth element with... | 1,000 | [
{
"input": "3\n3 1 2",
"output": "0"
},
{
"input": "2\n2 2",
"output": "1"
},
{
"input": "5\n5 3 3 3 1",
"output": "2"
},
{
"input": "5\n6 6 6 6 6",
"output": "5"
},
{
"input": "10\n1 1 2 2 8 8 7 7 9 9",
"output": "5"
},
{
"input": "8\n9 8 7 6 5 4 3 2"... | 1,604,762,024 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 18 | 2,000 | 307,200 | n=int(input())
s = list(map(int,input().rsplit()))
s.sort()
a=0
for i in range (1,n+1):
for j in range (0,n):
if s[j]==i:
break
if j==n-1:
a=a+1
print(a)
| Title: Permutation
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
"Hey, it's homework time" — thought Polycarpus and of course he started with his favourite subject, IT. Polycarpus managed to solve all tasks but for the last one in 20 minutes. However, as he failed to solve the last task ... | ```python
n=int(input())
s = list(map(int,input().rsplit()))
s.sort()
a=0
for i in range (1,n+1):
for j in range (0,n):
if s[j]==i:
break
if j==n-1:
a=a+1
print(a)
``` | 0 | |
38 | A | Army | PROGRAMMING | 800 | [
"implementation"
] | A. Army | 2 | 256 | The Berland Armed Forces System consists of *n* ranks that are numbered using natural numbers from 1 to *n*, where 1 is the lowest rank and *n* is the highest rank.
One needs exactly *d**i* years to rise from rank *i* to rank *i*<=+<=1. Reaching a certain rank *i* having not reached all the previous *i*<=-<=1 ranks is... | The first input line contains an integer *n* (2<=≤<=*n*<=≤<=100). The second line contains *n*<=-<=1 integers *d**i* (1<=≤<=*d**i*<=≤<=100). The third input line contains two integers *a* and *b* (1<=≤<=*a*<=<<=*b*<=≤<=*n*). The numbers on the lines are space-separated. | Print the single number which is the number of years that Vasya needs to rise from rank *a* to rank *b*. | [
"3\n5 6\n1 2\n",
"3\n5 6\n1 3\n"
] | [
"5\n",
"11\n"
] | none | 0 | [
{
"input": "3\n5 6\n1 2",
"output": "5"
},
{
"input": "3\n5 6\n1 3",
"output": "11"
},
{
"input": "2\n55\n1 2",
"output": "55"
},
{
"input": "3\n85 78\n1 3",
"output": "163"
},
{
"input": "4\n63 4 49\n2 3",
"output": "4"
},
{
"input": "5\n93 83 42 56\n... | 1,584,262,458 | 2,147,483,647 | Python 3 | OK | TESTS | 50 | 248 | 307,200 | n = int(input())
y = list(input().split())
y = [int(i) for i in y]
a, b = map(int, input().split())
count = 0
for i in range(b - a):
count += y[a - 1]
a += 1
print(count)
| Title: Army
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The Berland Armed Forces System consists of *n* ranks that are numbered using natural numbers from 1 to *n*, where 1 is the lowest rank and *n* is the highest rank.
One needs exactly *d**i* years to rise from rank *i* to rank *i*<=+<... | ```python
n = int(input())
y = list(input().split())
y = [int(i) for i in y]
a, b = map(int, input().split())
count = 0
for i in range(b - a):
count += y[a - 1]
a += 1
print(count)
``` | 3.937428 |
283 | C | Coin Troubles | PROGRAMMING | 2,100 | [
"dp"
] | null | null | In the Isle of Guernsey there are *n* different types of coins. For each *i* (1<=≤<=*i*<=≤<=*n*), coin of type *i* is worth *a**i* cents. It is possible that *a**i*<==<=*a**j* for some *i* and *j* (*i*<=≠<=*j*).
Bessie has some set of these coins totaling *t* cents. She tells Jessie *q* pairs of integers. For each *i... | The first line contains three space-separated integers, *n*,<=*q* and *t* (1<=≤<=*n*<=≤<=300; 0<=≤<=*q*<=≤<=*n*; 1<=≤<=*t*<=≤<=105). The second line contains *n* space separated integers, *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=105). The next *q* lines each contain two distinct space-separated integers, *b**i* and... | A single integer, the number of valid coin combinations that Bessie could have, modulo 1000000007 (109<=+<=7). | [
"4 2 17\n3 1 2 5\n4 2\n3 4\n",
"3 2 6\n3 1 1\n1 2\n2 3\n",
"3 2 10\n1 2 3\n1 2\n2 1\n"
] | [
"3\n",
"0\n",
"0\n"
] | For the first sample, the following 3 combinations give a total of 17 cents and satisfy the given conditions: {0 *of* *type* 1, 1 *of* *type* 2, 3 *of* *type* 3, 2 *of* *type* 4}, {0, 0, 6, 1}, {2, 0, 3, 1}.
No other combinations exist. Note that even though 4 occurs in both *b*<sub class="lower-index">*i*</sub> and *... | 1,500 | [
{
"input": "4 2 17\n3 1 2 5\n4 2\n3 4",
"output": "3"
},
{
"input": "3 2 6\n3 1 1\n1 2\n2 3",
"output": "0"
},
{
"input": "3 2 10\n1 2 3\n1 2\n2 1",
"output": "0"
},
{
"input": "10 0 97\n7 2 10 5 10 5 8 9 6 2",
"output": "823423"
},
{
"input": "10 2 11\n4 9 3 1 4 ... | 1,665,481,385 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 76 | 312 | 2,969,600 | '''
有n种价值为a[i]的硬币,某人拥有总值为t的硬币,已知q对数字(b,c)中,所有的b之间不同、
所有的c之间不同,其拥有的第b种币数量>第c种。求所有可能的方案数,并取模。
方案数为0的情况:数对表示的大小关系形成环(dfs检测环)
进行预处理之后使用完全背包
'''
R,P,G=lambda:map(int,input().split()),print,range;n,q,t=R();n+=1;a=[0]+[*R()]
# 图的预处理这块没看明白
g,d=[0]*n,[0]*n
for _ in G(q):u,v=R();g[u]=v;d[v]+=1
c=0
for u in G(1,n):
... | Title: Coin Troubles
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In the Isle of Guernsey there are *n* different types of coins. For each *i* (1<=≤<=*i*<=≤<=*n*), coin of type *i* is worth *a**i* cents. It is possible that *a**i*<==<=*a**j* for some *i* and *j* (*i*<=≠<=*j*).
Bessie ... | ```python
'''
有n种价值为a[i]的硬币,某人拥有总值为t的硬币,已知q对数字(b,c)中,所有的b之间不同、
所有的c之间不同,其拥有的第b种币数量>第c种。求所有可能的方案数,并取模。
方案数为0的情况:数对表示的大小关系形成环(dfs检测环)
进行预处理之后使用完全背包
'''
R,P,G=lambda:map(int,input().split()),print,range;n,q,t=R();n+=1;a=[0]+[*R()]
# 图的预处理这块没看明白
g,d=[0]*n,[0]*n
for _ in G(q):u,v=R();g[u]=v;d[v]+=1
c=0
for u in... | 3 | |
389 | A | Fox and Number Game | PROGRAMMING | 1,000 | [
"greedy",
"math"
] | null | null | Fox Ciel is playing a game with numbers now.
Ciel has *n* positive integers: *x*1, *x*2, ..., *x**n*. She can do the following operation as many times as needed: select two different indexes *i* and *j* such that *x**i* > *x**j* hold, and then apply assignment *x**i* = *x**i* - *x**j*. The goal is to make the sum ... | The first line contains an integer *n* (2<=≤<=*n*<=≤<=100). Then the second line contains *n* integers: *x*1, *x*2, ..., *x**n* (1<=≤<=*x**i*<=≤<=100). | Output a single integer — the required minimal sum. | [
"2\n1 2\n",
"3\n2 4 6\n",
"2\n12 18\n",
"5\n45 12 27 30 18\n"
] | [
"2\n",
"6\n",
"12\n",
"15\n"
] | In the first example the optimal way is to do the assignment: *x*<sub class="lower-index">2</sub> = *x*<sub class="lower-index">2</sub> - *x*<sub class="lower-index">1</sub>.
In the second example the optimal sequence of operations is: *x*<sub class="lower-index">3</sub> = *x*<sub class="lower-index">3</sub> - *x*<sub... | 500 | [
{
"input": "2\n1 2",
"output": "2"
},
{
"input": "3\n2 4 6",
"output": "6"
},
{
"input": "2\n12 18",
"output": "12"
},
{
"input": "5\n45 12 27 30 18",
"output": "15"
},
{
"input": "2\n1 1",
"output": "2"
},
{
"input": "2\n100 100",
"output": "200"
... | 1,595,859,682 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 4 | 109 | 20,172,800 |
n = int(input())
x = list(map(int, input().split()))
x = sorted(x)
y = []
for i in range(n-1):
y.append(x[-i-1]-x[-i-2])
y.append(x[0])
print(min(y)*n)
| Title: Fox and Number Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Fox Ciel is playing a game with numbers now.
Ciel has *n* positive integers: *x*1, *x*2, ..., *x**n*. She can do the following operation as many times as needed: select two different indexes *i* and *j* such that ... | ```python
n = int(input())
x = list(map(int, input().split()))
x = sorted(x)
y = []
for i in range(n-1):
y.append(x[-i-1]-x[-i-2])
y.append(x[0])
print(min(y)*n)
``` | 0 | |
22 | A | Second Order Statistics | PROGRAMMING | 800 | [
"brute force"
] | A. Second Order Statistics | 2 | 256 | Once Bob needed to find the second order statistics of a sequence of integer numbers. Lets choose each number from the sequence exactly once and sort them. The value on the second position is the second order statistics of the given sequence. In other words it is the smallest element strictly greater than the minimum. ... | The first input line contains integer *n* (1<=≤<=*n*<=≤<=100) — amount of numbers in the sequence. The second line contains *n* space-separated integer numbers — elements of the sequence. These numbers don't exceed 100 in absolute value. | If the given sequence has the second order statistics, output this order statistics, otherwise output NO. | [
"4\n1 2 2 -4\n",
"5\n1 2 3 1 1\n"
] | [
"1\n",
"2\n"
] | none | 0 | [
{
"input": "4\n1 2 2 -4",
"output": "1"
},
{
"input": "5\n1 2 3 1 1",
"output": "2"
},
{
"input": "1\n28",
"output": "NO"
},
{
"input": "2\n-28 12",
"output": "12"
},
{
"input": "3\n-83 40 -80",
"output": "-80"
},
{
"input": "8\n93 77 -92 26 21 -48 53 ... | 1,653,409,277 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 10 | 92 | 0 | n = int(input())
li1 = [int(x) for x in input().split()]
li2 = []
c = 0
if len(li1) > 1:
for i in li1:
if i not in li2:
li2.append(i)
li2.sort()
print(li2[1])
else:
print('NO')
| Title: Second Order Statistics
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Once Bob needed to find the second order statistics of a sequence of integer numbers. Lets choose each number from the sequence exactly once and sort them. The value on the second position is the second order statis... | ```python
n = int(input())
li1 = [int(x) for x in input().split()]
li2 = []
c = 0
if len(li1) > 1:
for i in li1:
if i not in li2:
li2.append(i)
li2.sort()
print(li2[1])
else:
print('NO')
``` | -1 |
567 | A | Lineland Mail | PROGRAMMING | 900 | [
"greedy",
"implementation"
] | null | null | All cities of Lineland are located on the *Ox* coordinate axis. Thus, each city is associated with its position *x**i* — a coordinate on the *Ox* axis. No two cities are located at a single point.
Lineland residents love to send letters to each other. A person may send a letter only if the recipient lives in another c... | The first line of the input contains integer *n* (2<=≤<=*n*<=≤<=105) — the number of cities in Lineland. The second line contains the sequence of *n* distinct integers *x*1,<=*x*2,<=...,<=*x**n* (<=-<=109<=≤<=*x**i*<=≤<=109), where *x**i* is the *x*-coordinate of the *i*-th city. All the *x**i*'s are distinct and follo... | Print *n* lines, the *i*-th line must contain two integers *min**i*,<=*max**i*, separated by a space, where *min**i* is the minimum cost of sending a letter from the *i*-th city, and *max**i* is the maximum cost of sending a letter from the *i*-th city. | [
"4\n-5 -2 2 7\n",
"2\n-1 1\n"
] | [
"3 12\n3 9\n4 7\n5 12\n",
"2 2\n2 2\n"
] | none | 500 | [
{
"input": "4\n-5 -2 2 7",
"output": "3 12\n3 9\n4 7\n5 12"
},
{
"input": "2\n-1 1",
"output": "2 2\n2 2"
},
{
"input": "3\n-1 0 1",
"output": "1 2\n1 1\n1 2"
},
{
"input": "4\n-1 0 1 3",
"output": "1 4\n1 3\n1 2\n2 4"
},
{
"input": "3\n-1000000000 0 1000000000",
... | 1,679,777,613 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 10 | 3,000 | 6,963,200 | n = int(input())
cities = [int(num) for num in input().split()]
for city in cities:
distances = []
for c in cities:
if c == city:
continue
if c > city:
distances.append(c - city)
else:
distances.append(city - c)
print(min(distances), m... | Title: Lineland Mail
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
All cities of Lineland are located on the *Ox* coordinate axis. Thus, each city is associated with its position *x**i* — a coordinate on the *Ox* axis. No two cities are located at a single point.
Lineland residents love... | ```python
n = int(input())
cities = [int(num) for num in input().split()]
for city in cities:
distances = []
for c in cities:
if c == city:
continue
if c > city:
distances.append(c - city)
else:
distances.append(city - c)
print(min(dis... | 0 | |
63 | A | Sinking Ship | PROGRAMMING | 900 | [
"implementation",
"sortings",
"strings"
] | A. Sinking Ship | 2 | 256 | The ship crashed into a reef and is sinking. Now the entire crew must be evacuated. All *n* crew members have already lined up in a row (for convenience let's label them all from left to right with positive integers from 1 to *n*) and await further instructions. However, one should evacuate the crew properly, in a stri... | The first line contains an integer *n*, which is the number of people in the crew (1<=≤<=*n*<=≤<=100). Then follow *n* lines. The *i*-th of those lines contains two words — the name of the crew member who is *i*-th in line, and his status on the ship. The words are separated by exactly one space. There are no other spa... | Print *n* lines. The *i*-th of them should contain the name of the crew member who must be the *i*-th one to leave the ship. | [
"6\nJack captain\nAlice woman\nCharlie man\nTeddy rat\nBob child\nJulia woman\n"
] | [
"Teddy\nAlice\nBob\nJulia\nCharlie\nJack\n"
] | none | 500 | [
{
"input": "6\nJack captain\nAlice woman\nCharlie man\nTeddy rat\nBob child\nJulia woman",
"output": "Teddy\nAlice\nBob\nJulia\nCharlie\nJack"
},
{
"input": "1\nA captain",
"output": "A"
},
{
"input": "1\nAbcdefjhij captain",
"output": "Abcdefjhij"
},
{
"input": "5\nA captain... | 1,580,761,017 | 2,147,483,647 | Python 3 | OK | TESTS | 26 | 216 | 307,200 | n = int(input())
in_list = []
cap = ""
rats = []
kd_w = []
m = []
for i in range(n):
curr = input()
mark = curr.split(" ")[1]
name = curr.split(" ")[0]
if mark == "rat":
rats.append(name)
elif mark == "woman" or mark == "child":
kd_w.append(name)
elif mark == ... | Title: Sinking Ship
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The ship crashed into a reef and is sinking. Now the entire crew must be evacuated. All *n* crew members have already lined up in a row (for convenience let's label them all from left to right with positive integers from 1 to ... | ```python
n = int(input())
in_list = []
cap = ""
rats = []
kd_w = []
m = []
for i in range(n):
curr = input()
mark = curr.split(" ")[1]
name = curr.split(" ")[0]
if mark == "rat":
rats.append(name)
elif mark == "woman" or mark == "child":
kd_w.append(name)
eli... | 3.945428 |
723 | A | The New Year: Meeting Friends | PROGRAMMING | 800 | [
"implementation",
"math",
"sortings"
] | null | null | There are three friend living on the straight line *Ox* in Lineland. The first friend lives at the point *x*1, the second friend lives at the point *x*2, and the third friend lives at the point *x*3. They plan to celebrate the New Year together, so they need to meet at one point. What is the minimum total distance they... | The first line of the input contains three distinct integers *x*1, *x*2 and *x*3 (1<=≤<=*x*1,<=*x*2,<=*x*3<=≤<=100) — the coordinates of the houses of the first, the second and the third friends respectively. | Print one integer — the minimum total distance the friends need to travel in order to meet together. | [
"7 1 4\n",
"30 20 10\n"
] | [
"6\n",
"20\n"
] | In the first sample, friends should meet at the point 4. Thus, the first friend has to travel the distance of 3 (from the point 7 to the point 4), the second friend also has to travel the distance of 3 (from the point 1 to the point 4), while the third friend should not go anywhere because he lives at the point 4. | 500 | [
{
"input": "7 1 4",
"output": "6"
},
{
"input": "30 20 10",
"output": "20"
},
{
"input": "1 4 100",
"output": "99"
},
{
"input": "100 1 91",
"output": "99"
},
{
"input": "1 45 100",
"output": "99"
},
{
"input": "1 2 3",
"output": "2"
},
{
"... | 1,690,001,418 | 2,147,483,647 | Python 3 | OK | TESTS | 48 | 46 | 0 | a = list(map(int, input().split()))
a.sort()
print(a[2]-a[0]) | Title: The New Year: Meeting Friends
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are three friend living on the straight line *Ox* in Lineland. The first friend lives at the point *x*1, the second friend lives at the point *x*2, and the third friend lives at the point *x*3. They ... | ```python
a = list(map(int, input().split()))
a.sort()
print(a[2]-a[0])
``` | 3 | |
237 | A | Free Cash | PROGRAMMING | 1,000 | [
"implementation"
] | null | null | Valera runs a 24/7 fast food cafe. He magically learned that next day *n* people will visit his cafe. For each person we know the arrival time: the *i*-th person comes exactly at *h**i* hours *m**i* minutes. The cafe spends less than a minute to serve each client, but if a client comes in and sees that there is no free... | The first line contains a single integer *n* (1<=≤<=*n*<=≤<=105), that is the number of cafe visitors.
Each of the following *n* lines has two space-separated integers *h**i* and *m**i* (0<=≤<=*h**i*<=≤<=23; 0<=≤<=*m**i*<=≤<=59), representing the time when the *i*-th person comes into the cafe.
Note that the time is... | Print a single integer — the minimum number of cashes, needed to serve all clients next day. | [
"4\n8 0\n8 10\n8 10\n8 45\n",
"3\n0 12\n10 11\n22 22\n"
] | [
"2\n",
"1\n"
] | In the first sample it is not enough one cash to serve all clients, because two visitors will come into cafe in 8:10. Therefore, if there will be one cash in cafe, then one customer will be served by it, and another one will not wait and will go away.
In the second sample all visitors will come in different times, so ... | 500 | [
{
"input": "4\n8 0\n8 10\n8 10\n8 45",
"output": "2"
},
{
"input": "3\n0 12\n10 11\n22 22",
"output": "1"
},
{
"input": "5\n12 8\n15 27\n15 27\n16 2\n19 52",
"output": "2"
},
{
"input": "7\n5 6\n7 34\n7 34\n7 34\n12 29\n15 19\n20 23",
"output": "3"
},
{
"input": "... | 1,626,456,942 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 3 | 92 | 6,963,200 | d=[]
f=[]
for i in range(int(input())):
a,b=map(int,input().split())
d.append(a)
f.append(b)
g=0
for i in range(len(d)):
j=d[i]
l=f[i]
k=i
for i in range(k+1,len(d)):
if j==d[i] and l==f[i]:
g+=1
print(1+g) | Title: Free Cash
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Valera runs a 24/7 fast food cafe. He magically learned that next day *n* people will visit his cafe. For each person we know the arrival time: the *i*-th person comes exactly at *h**i* hours *m**i* minutes. The cafe spends l... | ```python
d=[]
f=[]
for i in range(int(input())):
a,b=map(int,input().split())
d.append(a)
f.append(b)
g=0
for i in range(len(d)):
j=d[i]
l=f[i]
k=i
for i in range(k+1,len(d)):
if j==d[i] and l==f[i]:
g+=1
print(1+g)
``` | 0 | |
69 | A | Young Physicist | PROGRAMMING | 1,000 | [
"implementation",
"math"
] | A. Young Physicist | 2 | 256 | A guy named Vasya attends the final grade of a high school. One day Vasya decided to watch a match of his favorite hockey team. And, as the boy loves hockey very much, even more than physics, he forgot to do the homework. Specifically, he forgot to complete his physics tasks. Next day the teacher got very angry at Vasy... | The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100), then follow *n* lines containing three integers each: the *x**i* coordinate, the *y**i* coordinate and the *z**i* coordinate of the force vector, applied to the body (<=-<=100<=≤<=*x**i*,<=*y**i*,<=*z**i*<=≤<=100). | Print the word "YES" if the body is in equilibrium, or the word "NO" if it is not. | [
"3\n4 1 7\n-2 4 -1\n1 -5 -3\n",
"3\n3 -1 7\n-5 2 -4\n2 -1 -3\n"
] | [
"NO",
"YES"
] | none | 500 | [
{
"input": "3\n4 1 7\n-2 4 -1\n1 -5 -3",
"output": "NO"
},
{
"input": "3\n3 -1 7\n-5 2 -4\n2 -1 -3",
"output": "YES"
},
{
"input": "10\n21 32 -46\n43 -35 21\n42 2 -50\n22 40 20\n-27 -9 38\n-4 1 1\n-40 6 -31\n-13 -2 34\n-21 34 -12\n-32 -29 41",
"output": "NO"
},
{
"input": "10... | 1,635,329,970 | 2,147,483,647 | PyPy 3 | OK | TESTS | 81 | 186 | 17,715,200 | n = int(input())
a, b, c = 0, 0, 0
for i in range(n):
d, e, f = map(int, input().split())
a += d
b += e
c += f
print('YES' if a == 0 and b == 0 and c == 0 else 'NO') | Title: Young Physicist
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
A guy named Vasya attends the final grade of a high school. One day Vasya decided to watch a match of his favorite hockey team. And, as the boy loves hockey very much, even more than physics, he forgot to do the homework. S... | ```python
n = int(input())
a, b, c = 0, 0, 0
for i in range(n):
d, e, f = map(int, input().split())
a += d
b += e
c += f
print('YES' if a == 0 and b == 0 and c == 0 else 'NO')
``` | 3.920503 |
519 | B | A and B and Compilation Errors | PROGRAMMING | 1,100 | [
"data structures",
"implementation",
"sortings"
] | null | null | A and B are preparing themselves for programming contests.
B loves to debug his code. But before he runs the solution and starts debugging, he has to first compile the code.
Initially, the compiler displayed *n* compilation errors, each of them is represented as a positive integer. After some effort, B managed to fix... | The first line of the input contains integer *n* (3<=≤<=*n*<=≤<=105) — the initial number of compilation errors.
The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109) — the errors the compiler displayed for the first time.
The third line contains *n*<=-<=1 space-sepa... | Print two numbers on a single line: the numbers of the compilation errors that disappeared after B made the first and the second correction, respectively. | [
"5\n1 5 8 123 7\n123 7 5 1\n5 1 7\n",
"6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5\n"
] | [
"8\n123\n",
"1\n3\n"
] | In the first test sample B first corrects the error number 8, then the error number 123.
In the second test sample B first corrects the error number 1, then the error number 3. Note that if there are multiple errors with the same number, B can correct only one of them in one step. | 1,000 | [
{
"input": "5\n1 5 8 123 7\n123 7 5 1\n5 1 7",
"output": "8\n123"
},
{
"input": "6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5",
"output": "1\n3"
},
{
"input": "3\n1 2 3\n3 2\n2",
"output": "1\n3"
},
{
"input": "10\n460626451 802090732 277246428 661369649 388684428 784303821 376287098 6... | 1,665,969,935 | 2,147,483,647 | Python 3 | OK | TESTS | 33 | 170 | 9,523,200 | input()
soma_erros_1 = 0
for erro in list(map(int, input().split())):
soma_erros_1 += erro
soma_erros_2 = 0
for erro in list(map(int, input().split())):
soma_erros_2 += erro
soma_erros_3 = 0
for erro in list(map(int, input().split())):
soma_erros_3 += erro
erro_solucionado_1 = soma_erros_1... | Title: A and B and Compilation Errors
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A and B are preparing themselves for programming contests.
B loves to debug his code. But before he runs the solution and starts debugging, he has to first compile the code.
Initially, the compiler disp... | ```python
input()
soma_erros_1 = 0
for erro in list(map(int, input().split())):
soma_erros_1 += erro
soma_erros_2 = 0
for erro in list(map(int, input().split())):
soma_erros_2 += erro
soma_erros_3 = 0
for erro in list(map(int, input().split())):
soma_erros_3 += erro
erro_solucionado_1 = so... | 3 | |
371 | C | Hamburgers | PROGRAMMING | 1,600 | [
"binary search",
"brute force"
] | null | null | Polycarpus loves hamburgers very much. He especially adores the hamburgers he makes with his own hands. Polycarpus thinks that there are only three decent ingredients to make hamburgers from: a bread, sausage and cheese. He writes down the recipe of his favorite "Le Hamburger de Polycarpus" as a string of letters 'B' (... | The first line of the input contains a non-empty string that describes the recipe of "Le Hamburger de Polycarpus". The length of the string doesn't exceed 100, the string contains only letters 'B' (uppercase English B), 'S' (uppercase English S) and 'C' (uppercase English C).
The second line contains three integers *n... | Print the maximum number of hamburgers Polycarpus can make. If he can't make any hamburger, print 0. | [
"BBBSSC\n6 4 1\n1 2 3\n4\n",
"BBC\n1 10 1\n1 10 1\n21\n",
"BSC\n1 1 1\n1 1 3\n1000000000000\n"
] | [
"2\n",
"7\n",
"200000000001\n"
] | none | 1,500 | [
{
"input": "BBBSSC\n6 4 1\n1 2 3\n4",
"output": "2"
},
{
"input": "BBC\n1 10 1\n1 10 1\n21",
"output": "7"
},
{
"input": "BSC\n1 1 1\n1 1 3\n1000000000000",
"output": "200000000001"
},
{
"input": "B\n1 1 1\n1 1 1\n381",
"output": "382"
},
{
"input": "BSC\n3 5 6\n7... | 1,675,221,905 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 31 | 62 | 1,433,600 | recipe = input()
bread = recipe.count("B")
sausage = recipe.count("S")
cheese = recipe.count("C")
nB, nS, nC = map(int, input().split())
nBP, nSP, nCP = map(int, input().split())
rubles = int(input())
burger = 0
total_price = bread * nBP + sausage * nSP + cheese * nCP
if bread == 0:
nB = 0
if sausage == ... | Title: Hamburgers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarpus loves hamburgers very much. He especially adores the hamburgers he makes with his own hands. Polycarpus thinks that there are only three decent ingredients to make hamburgers from: a bread, sausage and cheese. He ... | ```python
recipe = input()
bread = recipe.count("B")
sausage = recipe.count("S")
cheese = recipe.count("C")
nB, nS, nC = map(int, input().split())
nBP, nSP, nCP = map(int, input().split())
rubles = int(input())
burger = 0
total_price = bread * nBP + sausage * nSP + cheese * nCP
if bread == 0:
nB = 0
if s... | 3 | |
591 | B | Rebranding | PROGRAMMING | 1,200 | [
"implementation",
"strings"
] | null | null | The name of one small but proud corporation consists of *n* lowercase English letters. The Corporation has decided to try rebranding — an active marketing strategy, that includes a set of measures to change either the brand (both for the company and the goods it produces) or its components: the name, the logo, the slog... | The first line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=200<=000) — the length of the initial name and the number of designers hired, respectively.
The second line consists of *n* lowercase English letters and represents the original name of the corporation.
Next *m* lines contain the descr... | Print the new name of the corporation. | [
"6 1\npolice\np m\n",
"11 6\nabacabadaba\na b\nb c\na d\ne g\nf a\nb b\n"
] | [
"molice\n",
"cdcbcdcfcdc\n"
] | In the second sample the name of the corporation consecutively changes as follows:
<img align="middle" class="tex-formula" src="https://espresso.codeforces.com/c7648432f7138ca53234357d7e08d1d119166055.png" style="max-width: 100.0%;max-height: 100.0%;"/>
<img align="middle" class="tex-formula" src="https://espresso.co... | 1,000 | [
{
"input": "6 1\npolice\np m",
"output": "molice"
},
{
"input": "11 6\nabacabadaba\na b\nb c\na d\ne g\nf a\nb b",
"output": "cdcbcdcfcdc"
},
{
"input": "1 1\nf\nz h",
"output": "f"
},
{
"input": "1 1\na\na b",
"output": "b"
},
{
"input": "10 10\nlellelleel\ne l\n... | 1,485,728,450 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 5 | 2,000 | 6,963,200 | import sys
size,swaps=map(int,sys.stdin.readline().split())
word=list(input())
alp=list('abcdefghijklmnopqrstuvwxyz')
for i in range(swaps):
a,b=map(str,sys.stdin.readline().split())
for j in range(26):
if alp[j]==a:
alp[j]=b
elif alp[j]==b:
alp[j]=a
for i in range(size):... | Title: Rebranding
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The name of one small but proud corporation consists of *n* lowercase English letters. The Corporation has decided to try rebranding — an active marketing strategy, that includes a set of measures to change either the brand ... | ```python
import sys
size,swaps=map(int,sys.stdin.readline().split())
word=list(input())
alp=list('abcdefghijklmnopqrstuvwxyz')
for i in range(swaps):
a,b=map(str,sys.stdin.readline().split())
for j in range(26):
if alp[j]==a:
alp[j]=b
elif alp[j]==b:
alp[j]=a
for i in ra... | 0 | |
66 | A | Petya and Java | PROGRAMMING | 1,300 | [
"implementation",
"strings"
] | A. Petya and Java | 2 | 256 | Little Petya has recently started attending a programming club. Naturally he is facing the problem of choosing a programming language. After long considerations he realized that Java is the best choice. The main argument in favor of choosing Java was that it has a very large integer data type, called BigInteger.
But h... | The first line contains a positive number *n*. It consists of no more than 100 digits and doesn't contain any leading zeros. The number *n* can't be represented as an empty string.
Please, do not use %lld specificator to read or write 64-bit integers in C++. It is preffered to use cout (also you may use %I64d). | Print the first type from the list "byte, short, int, long, BigInteger", that can store the natural number *n*, in accordance with the data given above. | [
"127\n",
"130\n",
"123456789101112131415161718192021222324\n"
] | [
"byte\n",
"short\n",
"BigInteger\n"
] | none | 500 | [
{
"input": "127",
"output": "byte"
},
{
"input": "130",
"output": "short"
},
{
"input": "123456789101112131415161718192021222324",
"output": "BigInteger"
},
{
"input": "6",
"output": "byte"
},
{
"input": "16",
"output": "byte"
},
{
"input": "126",
... | 1,630,202,026 | 2,147,483,647 | Python 3 | OK | TESTS | 90 | 154 | 6,758,400 | N=int(input())
if(-128<=N<=127):
print('byte')
elif(-32768<=N<=32767):
print('short')
elif(-2147483648<=N<=2147483647):
print('int')
elif((-(2**63))<=N<=(2**63-1)):
print('long')
else:
print('BigInteger') | Title: Petya and Java
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Little Petya has recently started attending a programming club. Naturally he is facing the problem of choosing a programming language. After long considerations he realized that Java is the best choice. The main argument in ... | ```python
N=int(input())
if(-128<=N<=127):
print('byte')
elif(-32768<=N<=32767):
print('short')
elif(-2147483648<=N<=2147483647):
print('int')
elif((-(2**63))<=N<=(2**63-1)):
print('long')
else:
print('BigInteger')
``` | 3.948911 |
22 | A | Second Order Statistics | PROGRAMMING | 800 | [
"brute force"
] | A. Second Order Statistics | 2 | 256 | Once Bob needed to find the second order statistics of a sequence of integer numbers. Lets choose each number from the sequence exactly once and sort them. The value on the second position is the second order statistics of the given sequence. In other words it is the smallest element strictly greater than the minimum. ... | The first input line contains integer *n* (1<=≤<=*n*<=≤<=100) — amount of numbers in the sequence. The second line contains *n* space-separated integer numbers — elements of the sequence. These numbers don't exceed 100 in absolute value. | If the given sequence has the second order statistics, output this order statistics, otherwise output NO. | [
"4\n1 2 2 -4\n",
"5\n1 2 3 1 1\n"
] | [
"1\n",
"2\n"
] | none | 0 | [
{
"input": "4\n1 2 2 -4",
"output": "1"
},
{
"input": "5\n1 2 3 1 1",
"output": "2"
},
{
"input": "1\n28",
"output": "NO"
},
{
"input": "2\n-28 12",
"output": "12"
},
{
"input": "3\n-83 40 -80",
"output": "-80"
},
{
"input": "8\n93 77 -92 26 21 -48 53 ... | 1,693,412,452 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 31 | 124 | 0 | n = int(input())
sequence = list(map(int, input().split()))
unique_sequence = sorted(set(sequence))
if len(unique_sequence) > 1:
print(unique_sequence[1])
else:
print("NO")
| Title: Second Order Statistics
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Once Bob needed to find the second order statistics of a sequence of integer numbers. Lets choose each number from the sequence exactly once and sort them. The value on the second position is the second order statis... | ```python
n = int(input())
sequence = list(map(int, input().split()))
unique_sequence = sorted(set(sequence))
if len(unique_sequence) > 1:
print(unique_sequence[1])
else:
print("NO")
``` | 3.969 |
928 | A | Login Verification | PROGRAMMING | 1,200 | [
"*special",
"strings"
] | null | null | When registering in a social network, users are allowed to create their own convenient login to make it easier to share contacts, print it on business cards, etc.
Login is an arbitrary sequence of lower and uppercase latin letters, digits and underline symbols («_»). However, in order to decrease the number of frauds ... | The first line contains a non-empty string *s* consisting of lower and uppercase latin letters, digits and underline symbols («_») with length not exceeding 50 — the login itself.
The second line contains a single integer *n* (1<=≤<=*n*<=≤<=1<=000) — the number of existing logins.
The next *n* lines describe the exi... | Print «Yes» (without quotes), if user can register via this login, i.e. none of the existing logins is similar with it.
Otherwise print «No» (without quotes). | [
"1_wat\n2\n2_wat\nwat_1\n",
"000\n3\n00\nooA\noOo\n",
"_i_\n3\n__i_\n_1_\nI\n",
"La0\n3\n2a0\nLa1\n1a0\n",
"abc\n1\naBc\n",
"0Lil\n2\nLIL0\n0Ril\n"
] | [
"Yes\n",
"No\n",
"No\n",
"No\n",
"No\n",
"Yes\n"
] | In the second sample case the user wants to create a login consisting of three zeros. It's impossible due to collision with the third among the existing.
In the third sample case the new login is similar with the second one. | 500 | [
{
"input": "1_wat\n2\n2_wat\nwat_1",
"output": "Yes"
},
{
"input": "000\n3\n00\nooA\noOo",
"output": "No"
},
{
"input": "_i_\n3\n__i_\n_1_\nI",
"output": "No"
},
{
"input": "La0\n3\n2a0\nLa1\n1a0",
"output": "No"
},
{
"input": "abc\n1\naBc",
"output": "No"
}... | 1,642,520,390 | 2,147,483,647 | Python 3 | OK | TESTS | 73 | 46 | 0 | def tq(q):
for i in range(len(q)):
if q[i]=="l" or q[i]=="i":
q[i]='1'
elif q[i]=="o":
q[i]='0'
p=[]
for i in q:
p+=[i]
return p
s=input()
s=s.lower()
s=list(s)
s=tq(s)
n=int(input())
while n>0:
s1=input()
s1=s1.lower()
s1=list(s1)
s1=tq(s1... | Title: Login Verification
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
When registering in a social network, users are allowed to create their own convenient login to make it easier to share contacts, print it on business cards, etc.
Login is an arbitrary sequence of lower and uppercas... | ```python
def tq(q):
for i in range(len(q)):
if q[i]=="l" or q[i]=="i":
q[i]='1'
elif q[i]=="o":
q[i]='0'
p=[]
for i in q:
p+=[i]
return p
s=input()
s=s.lower()
s=list(s)
s=tq(s)
n=int(input())
while n>0:
s1=input()
s1=s1.lower()
s1=list(s1)
... | 3 | |
9 | C | Hexadecimal's Numbers | PROGRAMMING | 1,200 | [
"brute force",
"implementation",
"math"
] | C. Hexadecimal's Numbers | 1 | 64 | One beautiful July morning a terrible thing happened in Mainframe: a mean virus Megabyte somehow got access to the memory of his not less mean sister Hexadecimal. He loaded there a huge amount of *n* different natural numbers from 1 to *n* to obtain total control over her energy.
But his plan failed. The reason for th... | Input data contains the only number *n* (1<=≤<=*n*<=≤<=109). | Output the only number — answer to the problem. | [
"10\n"
] | [
"2"
] | For *n* = 10 the answer includes numbers 1 and 10. | 0 | [
{
"input": "10",
"output": "2"
},
{
"input": "20",
"output": "3"
},
{
"input": "72",
"output": "3"
},
{
"input": "99",
"output": "3"
},
{
"input": "100",
"output": "4"
},
{
"input": "101",
"output": "5"
},
{
"input": "102",
"output": "5... | 1,547,711,555 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 1 | 186 | 0 | n = list(reversed(input()))
ans = 2 ** len(n) - 1
for i in range(len(n)):
if n[i] == "0":
ans -= 2 ** i
print(ans)
| Title: Hexadecimal's Numbers
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
One beautiful July morning a terrible thing happened in Mainframe: a mean virus Megabyte somehow got access to the memory of his not less mean sister Hexadecimal. He loaded there a huge amount of *n* different natural ... | ```python
n = list(reversed(input()))
ans = 2 ** len(n) - 1
for i in range(len(n)):
if n[i] == "0":
ans -= 2 ** i
print(ans)
``` | 0 |
719 | B | Anatoly and Cockroaches | PROGRAMMING | 1,400 | [
"greedy"
] | null | null | Anatoly lives in the university dorm as many other students do. As you know, cockroaches are also living there together with students. Cockroaches might be of two colors: black and red. There are *n* cockroaches living in Anatoly's room.
Anatoly just made all his cockroaches to form a single line. As he is a perfectio... | The first line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=100<=000) — the number of cockroaches.
The second line contains a string of length *n*, consisting of characters 'b' and 'r' that denote black cockroach and red cockroach respectively. | Print one integer — the minimum number of moves Anatoly has to perform in order to make the colors of cockroaches in the line to alternate. | [
"5\nrbbrr\n",
"5\nbbbbb\n",
"3\nrbr\n"
] | [
"1\n",
"2\n",
"0\n"
] | In the first sample, Anatoly has to swap third and fourth cockroaches. He needs 1 turn to do this.
In the second sample, the optimum answer is to paint the second and the fourth cockroaches red. This requires 2 turns.
In the third sample, the colors of cockroaches in the line are alternating already, thus the answer ... | 1,000 | [
{
"input": "5\nrbbrr",
"output": "1"
},
{
"input": "5\nbbbbb",
"output": "2"
},
{
"input": "3\nrbr",
"output": "0"
},
{
"input": "13\nrbbbrbrrbrrbb",
"output": "3"
},
{
"input": "18\nrrrrrrrrrrrrrrrrrb",
"output": "8"
},
{
"input": "100\nbrbbbrrrbbrbrb... | 1,474,735,450 | 2,147,483,647 | Python 3 | OK | TESTS | 46 | 109 | 307,200 | #!/usr/bin/env python
#-*-coding:utf-8 -*-
input()
S=4*[0]
e=0
for c in input():
S[e|('r'!=c)<<1]+=1
e=not e
print(min(max(S[0],S[3]),max(S[1],S[2])))
| Title: Anatoly and Cockroaches
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Anatoly lives in the university dorm as many other students do. As you know, cockroaches are also living there together with students. Cockroaches might be of two colors: black and red. There are *n* cockroaches... | ```python
#!/usr/bin/env python
#-*-coding:utf-8 -*-
input()
S=4*[0]
e=0
for c in input():
S[e|('r'!=c)<<1]+=1
e=not e
print(min(max(S[0],S[3]),max(S[1],S[2])))
``` | 3 | |
34 | A | Reconnaissance 2 | PROGRAMMING | 800 | [
"implementation"
] | A. Reconnaissance 2 | 2 | 256 | *n* soldiers stand in a circle. For each soldier his height *a**i* is known. A reconnaissance unit can be made of such two neighbouring soldiers, whose heights difference is minimal, i.e. |*a**i*<=-<=*a**j*| is minimal. So each of them will be less noticeable with the other. Output any pair of soldiers that can form a ... | The first line contains integer *n* (2<=≤<=*n*<=≤<=100) — amount of soldiers. Then follow the heights of the soldiers in their order in the circle — *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=1000). The soldier heights are given in clockwise or counterclockwise direction. | Output two integers — indexes of neighbouring soldiers, who should form a reconnaissance unit. If there are many optimum solutions, output any of them. Remember, that the soldiers stand in a circle. | [
"5\n10 12 13 15 10\n",
"4\n10 20 30 40\n"
] | [
"5 1\n",
"1 2\n"
] | none | 500 | [
{
"input": "5\n10 12 13 15 10",
"output": "5 1"
},
{
"input": "4\n10 20 30 40",
"output": "1 2"
},
{
"input": "6\n744 359 230 586 944 442",
"output": "2 3"
},
{
"input": "5\n826 747 849 687 437",
"output": "1 2"
},
{
"input": "5\n999 999 993 969 999",
"output"... | 1,630,511,898 | 2,147,483,647 | Python 3 | OK | TESTS | 20 | 154 | 6,963,200 | n=int(input())
l=[int(x) for x in input().split()]
c=abs(l[0]-l[1])
ind=0
for i in range(1,n-1):
if abs(l[i]-l[i+1])<c:
c=abs(l[i]-l[i+1])
ind=i
if abs(l[0]-l[n-1])<c:
ind=n-1
print(ind+1,(ind+1)%n+1) | Title: Reconnaissance 2
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
*n* soldiers stand in a circle. For each soldier his height *a**i* is known. A reconnaissance unit can be made of such two neighbouring soldiers, whose heights difference is minimal, i.e. |*a**i*<=-<=*a**j*| is minimal. So... | ```python
n=int(input())
l=[int(x) for x in input().split()]
c=abs(l[0]-l[1])
ind=0
for i in range(1,n-1):
if abs(l[i]-l[i+1])<c:
c=abs(l[i]-l[i+1])
ind=i
if abs(l[0]-l[n-1])<c:
ind=n-1
print(ind+1,(ind+1)%n+1)
``` | 3.94853 |
854 | A | Fraction | PROGRAMMING | 800 | [
"brute force",
"constructive algorithms",
"math"
] | null | null | Petya is a big fan of mathematics, especially its part related to fractions. Recently he learned that a fraction is called proper iff its numerator is smaller than its denominator (*a*<=<<=*b*) and that the fraction is called irreducible if its numerator and its denominator are coprime (they do not have positive co... | In the only line of input there is an integer *n* (3<=≤<=*n*<=≤<=1000), the sum of numerator and denominator of the fraction. | Output two space-separated positive integers *a* and *b*, numerator and denominator of the maximum possible proper irreducible fraction satisfying the given sum. | [
"3\n",
"4\n",
"12\n"
] | [
"1 2\n",
"1 3\n",
"5 7\n"
] | none | 500 | [
{
"input": "3",
"output": "1 2"
},
{
"input": "4",
"output": "1 3"
},
{
"input": "12",
"output": "5 7"
},
{
"input": "34",
"output": "15 19"
},
{
"input": "13",
"output": "6 7"
},
{
"input": "11",
"output": "5 6"
},
{
"input": "24",
"ou... | 1,597,395,828 | 2,147,483,647 | Python 3 | COMPILATION_ERROR | TESTS | 0 | 0 | 0 | a = 1
b =2
if (a==b)
print(a) | Title: Fraction
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya is a big fan of mathematics, especially its part related to fractions. Recently he learned that a fraction is called proper iff its numerator is smaller than its denominator (*a*<=<<=*b*) and that the fraction is cal... | ```python
a = 1
b =2
if (a==b)
print(a)
``` | -1 | |
137 | B | Permutation | PROGRAMMING | 1,000 | [
"greedy"
] | null | null | "Hey, it's homework time" — thought Polycarpus and of course he started with his favourite subject, IT. Polycarpus managed to solve all tasks but for the last one in 20 minutes. However, as he failed to solve the last task after some considerable time, the boy asked you to help him.
The sequence of *n* integers is cal... | The first line of the input data contains an integer *n* (1<=≤<=*n*<=≤<=5000) which represents how many numbers are in the sequence. The second line contains a sequence of integers *a**i* (1<=≤<=*a**i*<=≤<=5000,<=1<=≤<=*i*<=≤<=*n*). | Print the only number — the minimum number of changes needed to get the permutation. | [
"3\n3 1 2\n",
"2\n2 2\n",
"5\n5 3 3 3 1\n"
] | [
"0\n",
"1\n",
"2\n"
] | The first sample contains the permutation, which is why no replacements are required.
In the second sample it is enough to replace the first element with the number 1 and that will make the sequence the needed permutation.
In the third sample we can replace the second element with number 4 and the fourth element with... | 1,000 | [
{
"input": "3\n3 1 2",
"output": "0"
},
{
"input": "2\n2 2",
"output": "1"
},
{
"input": "5\n5 3 3 3 1",
"output": "2"
},
{
"input": "5\n6 6 6 6 6",
"output": "5"
},
{
"input": "10\n1 1 2 2 8 8 7 7 9 9",
"output": "5"
},
{
"input": "8\n9 8 7 6 5 4 3 2"... | 1,420,166,527 | 2,147,483,647 | Python 3 | OK | TESTS | 48 | 154 | 307,200 | def main():
n = int(input())
i, res = 1, 0
for a in sorted(map(int, input().split())):
if i <= a <= n:
i = a + 1
else:
res += 1
print(res)
if __name__ == '__main__':
main() | Title: Permutation
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
"Hey, it's homework time" — thought Polycarpus and of course he started with his favourite subject, IT. Polycarpus managed to solve all tasks but for the last one in 20 minutes. However, as he failed to solve the last task ... | ```python
def main():
n = int(input())
i, res = 1, 0
for a in sorted(map(int, input().split())):
if i <= a <= n:
i = a + 1
else:
res += 1
print(res)
if __name__ == '__main__':
main()
``` | 3 | |
133 | A | HQ9+ | PROGRAMMING | 900 | [
"implementation"
] | null | null | HQ9+ is a joke programming language which has only four one-character instructions:
- "H" prints "Hello, World!",- "Q" prints the source code of the program itself,- "9" prints the lyrics of "99 Bottles of Beer" song, - "+" increments the value stored in the internal accumulator.
Instructions "H" and "Q" are case-s... | The input will consist of a single line *p* which will give a program in HQ9+. String *p* will contain between 1 and 100 characters, inclusive. ASCII-code of each character of *p* will be between 33 (exclamation mark) and 126 (tilde), inclusive. | Output "YES", if executing the program will produce any output, and "NO" otherwise. | [
"Hi!\n",
"Codeforces\n"
] | [
"YES\n",
"NO\n"
] | In the first case the program contains only one instruction — "H", which prints "Hello, World!".
In the second case none of the program characters are language instructions. | 500 | [
{
"input": "Hi!",
"output": "YES"
},
{
"input": "Codeforces",
"output": "NO"
},
{
"input": "a+b=c",
"output": "NO"
},
{
"input": "hq-lowercase",
"output": "NO"
},
{
"input": "Q",
"output": "YES"
},
{
"input": "9",
"output": "YES"
},
{
"inpu... | 1,685,819,060 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 2 | 92 | 0 | a = input()
ans = 0
for i in a:
if i == 'H' or i == 'Q' or i == '9' or i == '+':
print('YES')
break
else:
ans += 1
if ans == len(a):
print('NO') | Title: HQ9+
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
HQ9+ is a joke programming language which has only four one-character instructions:
- "H" prints "Hello, World!",- "Q" prints the source code of the program itself,- "9" prints the lyrics of "99 Bottles of Beer" song, - "+" in... | ```python
a = input()
ans = 0
for i in a:
if i == 'H' or i == 'Q' or i == '9' or i == '+':
print('YES')
break
else:
ans += 1
if ans == len(a):
print('NO')
``` | 0 | |
940 | B | Our Tanya is Crying Out Loud | PROGRAMMING | 1,400 | [
"dp",
"greedy"
] | null | null | Right now she actually isn't. But she will be, if you don't solve this problem.
You are given integers *n*, *k*, *A* and *B*. There is a number *x*, which is initially equal to *n*. You are allowed to perform two types of operations:
1. Subtract 1 from *x*. This operation costs you *A* coins. 1. Divide *x* by *k*.... | The first line contains a single integer *n* (1<=≤<=*n*<=≤<=2·109).
The second line contains a single integer *k* (1<=≤<=*k*<=≤<=2·109).
The third line contains a single integer *A* (1<=≤<=*A*<=≤<=2·109).
The fourth line contains a single integer *B* (1<=≤<=*B*<=≤<=2·109). | Output a single integer — the minimum amount of coins you have to pay to make *x* equal to 1. | [
"9\n2\n3\n1\n",
"5\n5\n2\n20\n",
"19\n3\n4\n2\n"
] | [
"6\n",
"8\n",
"12\n"
] | In the first testcase, the optimal strategy is as follows:
- Subtract 1 from *x* (9 → 8) paying 3 coins. - Divide *x* by 2 (8 → 4) paying 1 coin. - Divide *x* by 2 (4 → 2) paying 1 coin. - Divide *x* by 2 (2 → 1) paying 1 coin.
The total cost is 6 coins.
In the second test case the optimal strategy is to subtra... | 1,250 | [
{
"input": "9\n2\n3\n1",
"output": "6"
},
{
"input": "5\n5\n2\n20",
"output": "8"
},
{
"input": "19\n3\n4\n2",
"output": "12"
},
{
"input": "1845999546\n999435865\n1234234\n2323423",
"output": "1044857680578777"
},
{
"input": "1604353664\n1604353665\n9993432\n1",
... | 1,519,495,242 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 6 | 1,000 | 5,632,000 | n=int(input())
k=int(input())
a=int(input())
b=int(input())
sum=0
x=n
if k==1:
print((n-1)*a)
else:
while x!=1:
if x<k:
sum+=(x-1)*a
x=1
elif x%k!=0:
sum+=(a*(x%k))
x=x-(x%k)
elif ((x-x/k)*a)>=b:
x//=k
... | Title: Our Tanya is Crying Out Loud
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Right now she actually isn't. But she will be, if you don't solve this problem.
You are given integers *n*, *k*, *A* and *B*. There is a number *x*, which is initially equal to *n*. You are allowed to perf... | ```python
n=int(input())
k=int(input())
a=int(input())
b=int(input())
sum=0
x=n
if k==1:
print((n-1)*a)
else:
while x!=1:
if x<k:
sum+=(x-1)*a
x=1
elif x%k!=0:
sum+=(a*(x%k))
x=x-(x%k)
elif ((x-x/k)*a)>=b:
x//=k... | 0 | |
893 | A | Chess For Three | PROGRAMMING | 900 | [
"implementation"
] | null | null | Alex, Bob and Carl will soon participate in a team chess tournament. Since they are all in the same team, they have decided to practise really hard before the tournament. But it's a bit difficult for them because chess is a game for two players, not three.
So they play with each other according to following rules:
- ... | The first line contains one integer *n* (1<=≤<=*n*<=≤<=100) — the number of games Alex, Bob and Carl played.
Then *n* lines follow, describing the game log. *i*-th line contains one integer *a**i* (1<=≤<=*a**i*<=≤<=3) which is equal to 1 if Alex won *i*-th game, to 2 if Bob won *i*-th game and 3 if Carl won *i*-th gam... | Print YES if the situation described in the log was possible. Otherwise print NO. | [
"3\n1\n1\n2\n",
"2\n1\n2\n"
] | [
"YES\n",
"NO\n"
] | In the first example the possible situation is:
1. Alex wins, Carl starts playing instead of Bob; 1. Alex wins, Bob replaces Carl; 1. Bob wins.
The situation in the second example is impossible because Bob loses the first game, so he cannot win the second one. | 0 | [
{
"input": "3\n1\n1\n2",
"output": "YES"
},
{
"input": "2\n1\n2",
"output": "NO"
},
{
"input": "100\n2\n3\n1\n2\n3\n3\n3\n1\n1\n1\n1\n3\n3\n3\n3\n1\n2\n3\n3\n3\n3\n3\n3\n3\n1\n2\n2\n2\n3\n1\n1\n3\n3\n3\n3\n3\n3\n3\n3\n1\n2\n3\n3\n3\n1\n1\n1\n1\n3\n3\n3\n3\n1\n2\n3\n1\n2\n2\n2\n3\n3\n2\n1... | 1,623,836,998 | 2,147,483,647 | Python 3 | OK | TESTS | 37 | 62 | 0 | n = int(input())
a, b, c, x = True, True, False, []
d, s = {1: a, 2: b, 3: c}, [1, 2, 3]
for i in range(n):
x.append(int(input()))
for i in range(n):
if d[x[i]]:
b = list(s)
b.remove(x[i])
for j in b:
d[j] = not d[j]
else:
exit(print("NO"))
print("YES... | Title: Chess For Three
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Alex, Bob and Carl will soon participate in a team chess tournament. Since they are all in the same team, they have decided to practise really hard before the tournament. But it's a bit difficult for them because chess ... | ```python
n = int(input())
a, b, c, x = True, True, False, []
d, s = {1: a, 2: b, 3: c}, [1, 2, 3]
for i in range(n):
x.append(int(input()))
for i in range(n):
if d[x[i]]:
b = list(s)
b.remove(x[i])
for j in b:
d[j] = not d[j]
else:
exit(print("NO"))
... | 3 | |
998 | B | Cutting | PROGRAMMING | 1,200 | [
"dp",
"greedy",
"sortings"
] | null | null | There are a lot of things which could be cut — trees, paper, "the rope". In this problem you are going to cut a sequence of integers.
There is a sequence of integers, which contains the equal number of even and odd numbers. Given a limited budget, you need to make maximum possible number of cuts such that each resulti... | First line of the input contains an integer $n$ ($2 \le n \le 100$) and an integer $B$ ($1 \le B \le 100$) — the number of elements in the sequence and the number of bitcoins you have.
Second line contains $n$ integers: $a_1$, $a_2$, ..., $a_n$ ($1 \le a_i \le 100$) — elements of the sequence, which contains the equal... | Print the maximum possible number of cuts which can be made while spending no more than $B$ bitcoins. | [
"6 4\n1 2 5 10 15 20\n",
"4 10\n1 3 2 4\n",
"6 100\n1 2 3 4 5 6\n"
] | [
"1\n",
"0\n",
"2\n"
] | In the first sample the optimal answer is to split sequence between $2$ and $5$. Price of this cut is equal to $3$ bitcoins.
In the second sample it is not possible to make even one cut even with unlimited number of bitcoins.
In the third sample the sequence should be cut between $2$ and $3$, and between $4$ and $5$.... | 1,000 | [
{
"input": "6 4\n1 2 5 10 15 20",
"output": "1"
},
{
"input": "4 10\n1 3 2 4",
"output": "0"
},
{
"input": "6 100\n1 2 3 4 5 6",
"output": "2"
},
{
"input": "2 100\n13 78",
"output": "0"
},
{
"input": "10 1\n56 56 98 2 11 64 97 41 95 53",
"output": "0"
},
... | 1,558,269,033 | 2,147,483,647 | Python 3 | OK | TESTS | 34 | 140 | 512,000 | # Lets goto the next level
# AIM Specialist at CF *__* asap
# template taken from chaudhary_19
# Remember you were also a novice when you started,
# hence never be rude to anyone who wants to learn something
# Never open a ranklist untill and unless you are done with solving problems, wastes 3/4 minuts
# Do... | Title: Cutting
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are a lot of things which could be cut — trees, paper, "the rope". In this problem you are going to cut a sequence of integers.
There is a sequence of integers, which contains the equal number of even and odd numbers. Gi... | ```python
# Lets goto the next level
# AIM Specialist at CF *__* asap
# template taken from chaudhary_19
# Remember you were also a novice when you started,
# hence never be rude to anyone who wants to learn something
# Never open a ranklist untill and unless you are done with solving problems, wastes 3/4 min... | 3 | |
50 | A | Domino piling | PROGRAMMING | 800 | [
"greedy",
"math"
] | A. Domino piling | 2 | 256 | You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers ... | In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16). | Output one number — the maximal number of dominoes, which can be placed. | [
"2 4\n",
"3 3\n"
] | [
"4\n",
"4\n"
] | none | 500 | [
{
"input": "2 4",
"output": "4"
},
{
"input": "3 3",
"output": "4"
},
{
"input": "1 5",
"output": "2"
},
{
"input": "1 6",
"output": "3"
},
{
"input": "1 15",
"output": "7"
},
{
"input": "1 16",
"output": "8"
},
{
"input": "2 5",
"outpu... | 1,644,587,564 | 2,147,483,647 | Python 3 | OK | TESTS | 35 | 92 | 0 | m,n = input().split()
casillas = int(m)*int(n)
p = 0
final = 0
for i in range(casillas):
p = p + 2
if p <= int(casillas):
final += 1
elif p == casillas:
print(final)
exit()
elif p > casillas:
print(final)
exit()
| Title: Domino piling
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as p... | ```python
m,n = input().split()
casillas = int(m)*int(n)
p = 0
final = 0
for i in range(casillas):
p = p + 2
if p <= int(casillas):
final += 1
elif p == casillas:
print(final)
exit()
elif p > casillas:
print(final)
exit()
``` | 3.977 |
262 | A | Roma and Lucky Numbers | PROGRAMMING | 800 | [
"implementation"
] | null | null | Roma (a popular Russian name that means 'Roman') loves the Little Lvov Elephant's lucky numbers.
Let us remind you that lucky numbers are positive integers whose decimal representation only contains lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not.
Roma's got *n* positive integer... | The first line contains two integers *n*, *k* (1<=≤<=*n*,<=*k*<=≤<=100). The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=109) — the numbers that Roma has.
The numbers in the lines are separated by single spaces. | In a single line print a single integer — the answer to the problem. | [
"3 4\n1 2 4\n",
"3 2\n447 44 77\n"
] | [
"3\n",
"2\n"
] | In the first sample all numbers contain at most four lucky digits, so the answer is 3.
In the second sample number 447 doesn't fit in, as it contains more than two lucky digits. All other numbers are fine, so the answer is 2. | 500 | [
{
"input": "3 4\n1 2 4",
"output": "3"
},
{
"input": "3 2\n447 44 77",
"output": "2"
},
{
"input": "2 2\n507978501 180480073",
"output": "2"
},
{
"input": "9 6\n655243746 167613748 1470546 57644035 176077477 56984809 44677 215706823 369042089",
"output": "9"
},
{
... | 1,655,984,112 | 2,147,483,647 | Python 3 | OK | TESTS | 34 | 92 | 0 | def main():
[_, k] = list(map(int, input().split()))
ns = input().split()
t = 0
for n in ns:
q = 0
for c in str(n):
if c == '4' or c == '7':
q += 1
if q <= k:
t += 1
print(t)
if __name__ == "__main__":
main()
| Title: Roma and Lucky Numbers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Roma (a popular Russian name that means 'Roman') loves the Little Lvov Elephant's lucky numbers.
Let us remind you that lucky numbers are positive integers whose decimal representation only contains lucky digits... | ```python
def main():
[_, k] = list(map(int, input().split()))
ns = input().split()
t = 0
for n in ns:
q = 0
for c in str(n):
if c == '4' or c == '7':
q += 1
if q <= k:
t += 1
print(t)
if __name__ == "__main__":
... | 3 | |
977 | A | Wrong Subtraction | PROGRAMMING | 800 | [
"implementation"
] | null | null | Little girl Tanya is learning how to decrease a number by one, but she does it wrong with a number consisting of two or more digits. Tanya subtracts one from a number by the following algorithm:
- if the last digit of the number is non-zero, she decreases the number by one; - if the last digit of the number is zero,... | The first line of the input contains two integer numbers $n$ and $k$ ($2 \le n \le 10^9$, $1 \le k \le 50$) — the number from which Tanya will subtract and the number of subtractions correspondingly. | Print one integer number — the result of the decreasing $n$ by one $k$ times.
It is guaranteed that the result will be positive integer number. | [
"512 4\n",
"1000000000 9\n"
] | [
"50\n",
"1\n"
] | The first example corresponds to the following sequence: $512 \rightarrow 511 \rightarrow 510 \rightarrow 51 \rightarrow 50$. | 0 | [
{
"input": "512 4",
"output": "50"
},
{
"input": "1000000000 9",
"output": "1"
},
{
"input": "131203 11",
"output": "12"
},
{
"input": "999999999 50",
"output": "9999"
},
{
"input": "999999999 49",
"output": "99990"
},
{
"input": "131203 9",
"outpu... | 1,698,563,432 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 11 | 61 | 0 | n, k = map(int, input().split())
cnt = 0
while cnt < k:
if n % 10 != 0:
n -= 1
else:
n //= 10
cnt += 1
print(n) | Title: Wrong Subtraction
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Little girl Tanya is learning how to decrease a number by one, but she does it wrong with a number consisting of two or more digits. Tanya subtracts one from a number by the following algorithm:
- if the last digit ... | ```python
n, k = map(int, input().split())
cnt = 0
while cnt < k:
if n % 10 != 0:
n -= 1
else:
n //= 10
cnt += 1
print(n)
``` | 3 | |
609 | A | USB Flash Drives | PROGRAMMING | 800 | [
"greedy",
"implementation",
"sortings"
] | null | null | Sean is trying to save a large file to a USB flash drive. He has *n* USB flash drives with capacities equal to *a*1,<=*a*2,<=...,<=*a**n* megabytes. The file size is equal to *m* megabytes.
Find the minimum number of USB flash drives needed to write Sean's file, if he can split the file between drives. | The first line contains positive integer *n* (1<=≤<=*n*<=≤<=100) — the number of USB flash drives.
The second line contains positive integer *m* (1<=≤<=*m*<=≤<=105) — the size of Sean's file.
Each of the next *n* lines contains positive integer *a**i* (1<=≤<=*a**i*<=≤<=1000) — the sizes of USB flash drives in megabyt... | Print the minimum number of USB flash drives to write Sean's file, if he can split the file between drives. | [
"3\n5\n2\n1\n3\n",
"3\n6\n2\n3\n2\n",
"2\n5\n5\n10\n"
] | [
"2\n",
"3\n",
"1\n"
] | In the first example Sean needs only two USB flash drives — the first and the third.
In the second example Sean needs all three USB flash drives.
In the third example Sean needs only one USB flash drive and he can use any available USB flash drive — the first or the second. | 0 | [
{
"input": "3\n5\n2\n1\n3",
"output": "2"
},
{
"input": "3\n6\n2\n3\n2",
"output": "3"
},
{
"input": "2\n5\n5\n10",
"output": "1"
},
{
"input": "5\n16\n8\n1\n3\n4\n9",
"output": "2"
},
{
"input": "10\n121\n10\n37\n74\n56\n42\n39\n6\n68\n8\n100",
"output": "2"
... | 1,567,814,643 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 6 | 108 | 0 | a=int(input())
b=int(input())
k=[]
for i in range(a):
k.append(int(input()))
tot=sum(k)
tot1=sum(k)
if tot==b:
print(a)
while k!=[]:
minIndex = k.index(min(k))
tot=tot1
tot1=tot1-min(k)
k.pop(minIndex)
if tot1<b:
print(len(k)+1)
break
... | Title: USB Flash Drives
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Sean is trying to save a large file to a USB flash drive. He has *n* USB flash drives with capacities equal to *a*1,<=*a*2,<=...,<=*a**n* megabytes. The file size is equal to *m* megabytes.
Find the minimum number of... | ```python
a=int(input())
b=int(input())
k=[]
for i in range(a):
k.append(int(input()))
tot=sum(k)
tot1=sum(k)
if tot==b:
print(a)
while k!=[]:
minIndex = k.index(min(k))
tot=tot1
tot1=tot1-min(k)
k.pop(minIndex)
if tot1<b:
print(len(k)+1)
break
... | 0 | |
702 | A | Maximum Increase | PROGRAMMING | 800 | [
"dp",
"greedy",
"implementation"
] | null | null | You are given array consisting of *n* integers. Your task is to find the maximum length of an increasing subarray of the given array.
A subarray is the sequence of consecutive elements of the array. Subarray is called increasing if each element of this subarray strictly greater than previous. | The first line contains single positive integer *n* (1<=≤<=*n*<=≤<=105) — the number of integers.
The second line contains *n* positive integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109). | Print the maximum length of an increasing subarray of the given array. | [
"5\n1 7 2 11 15\n",
"6\n100 100 100 100 100 100\n",
"3\n1 2 3\n"
] | [
"3\n",
"1\n",
"3\n"
] | none | 0 | [
{
"input": "5\n1 7 2 11 15",
"output": "3"
},
{
"input": "6\n100 100 100 100 100 100",
"output": "1"
},
{
"input": "3\n1 2 3",
"output": "3"
},
{
"input": "1\n1000000000",
"output": "1"
},
{
"input": "10\n802030518 598196518 640274071 983359971 71550121 96204862 7... | 1,654,315,933 | 2,147,483,647 | Python 3 | OK | TESTS | 32 | 108 | 7,884,800 | n = int(input())
l = list(map(int, input().split()))
count = 1
max_ = 1
for i in range(len(l)-1):
if l[i] < l[i+1]:
# print(l[i], l[i+1])
count += 1
# print(max_, count)
else:
if max_ < count:
max_ = count
count = 1
print(max(max_, count)) | Title: Maximum Increase
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given array consisting of *n* integers. Your task is to find the maximum length of an increasing subarray of the given array.
A subarray is the sequence of consecutive elements of the array. Subarray is called... | ```python
n = int(input())
l = list(map(int, input().split()))
count = 1
max_ = 1
for i in range(len(l)-1):
if l[i] < l[i+1]:
# print(l[i], l[i+1])
count += 1
# print(max_, count)
else:
if max_ < count:
max_ = count
count = 1
print(max(max_, count... | 3 | |
816 | A | Karen and Morning | PROGRAMMING | 1,000 | [
"brute force",
"implementation"
] | null | null | Karen is getting ready for a new school day!
It is currently hh:mm, given in a 24-hour format. As you know, Karen loves palindromes, and she believes that it is good luck to wake up when the time is a palindrome.
What is the minimum number of minutes she should sleep, such that, when she wakes up, the time is a palin... | The first and only line of input contains a single string in the format hh:mm (00<=≤<= hh <=≤<=23, 00<=≤<= mm <=≤<=59). | Output a single integer on a line by itself, the minimum number of minutes she should sleep, such that, when she wakes up, the time is a palindrome. | [
"05:39\n",
"13:31\n",
"23:59\n"
] | [
"11\n",
"0\n",
"1\n"
] | In the first test case, the minimum number of minutes Karen should sleep for is 11. She can wake up at 05:50, when the time is a palindrome.
In the second test case, Karen can wake up immediately, as the current time, 13:31, is already a palindrome.
In the third test case, the minimum number of minutes Karen should s... | 500 | [
{
"input": "05:39",
"output": "11"
},
{
"input": "13:31",
"output": "0"
},
{
"input": "23:59",
"output": "1"
},
{
"input": "13:32",
"output": "69"
},
{
"input": "14:40",
"output": "1"
},
{
"input": "14:00",
"output": "41"
},
{
"input": "05:... | 1,627,153,090 | 2,147,483,647 | Python 3 | OK | TESTS | 160 | 77 | 6,758,400 | h,m=map(int,input().split(":"))
i=0
while h//10!=m%10 or h%10!=m//10:
m=m+1
i=i+1
if m==60:
m=0
h=h+1
h=h%24
print(i) | Title: Karen and Morning
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Karen is getting ready for a new school day!
It is currently hh:mm, given in a 24-hour format. As you know, Karen loves palindromes, and she believes that it is good luck to wake up when the time is a palindrome.
Wh... | ```python
h,m=map(int,input().split(":"))
i=0
while h//10!=m%10 or h%10!=m//10:
m=m+1
i=i+1
if m==60:
m=0
h=h+1
h=h%24
print(i)
``` | 3 | |
873 | B | Balanced Substring | PROGRAMMING | 1,500 | [
"dp",
"implementation"
] | null | null | You are given a string *s* consisting only of characters 0 and 1. A substring [*l*,<=*r*] of *s* is a string *s**l**s**l*<=+<=1*s**l*<=+<=2... *s**r*, and its length equals to *r*<=-<=*l*<=+<=1. A substring is called balanced if the number of zeroes (0) equals to the number of ones in this substring.
You have to deter... | The first line contains *n* (1<=≤<=*n*<=≤<=100000) — the number of characters in *s*.
The second line contains a string *s* consisting of exactly *n* characters. Only characters 0 and 1 can appear in *s*. | If there is no non-empty balanced substring in *s*, print 0. Otherwise, print the length of the longest balanced substring. | [
"8\n11010111\n",
"3\n111\n"
] | [
"4\n",
"0\n"
] | In the first example you can choose the substring [3, 6]. It is balanced, and its length is 4. Choosing the substring [2, 5] is also possible.
In the second example it's impossible to find a non-empty balanced substring. | 0 | [
{
"input": "8\n11010111",
"output": "4"
},
{
"input": "3\n111",
"output": "0"
},
{
"input": "11\n00001000100",
"output": "2"
},
{
"input": "10\n0100000000",
"output": "2"
},
{
"input": "13\n0001000011010",
"output": "6"
},
{
"input": "14\n0000010010101... | 1,694,448,020 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 31 | 0 | def prefix(string, num=0):
pref = []
pref.append(0)
for i in range(1, len(string)+1):
if int(string[i-1]) == num:
pref.append(pref[i - 1] + 1)
else:
pref.append(pref[i - 1])
return pref
n = int(input())
str1 = input()
res1 = prefix(str1)
res2 = prefix(str1, 1)
ma... | Title: Balanced Substring
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given a string *s* consisting only of characters 0 and 1. A substring [*l*,<=*r*] of *s* is a string *s**l**s**l*<=+<=1*s**l*<=+<=2... *s**r*, and its length equals to *r*<=-<=*l*<=+<=1. A substring is called... | ```python
def prefix(string, num=0):
pref = []
pref.append(0)
for i in range(1, len(string)+1):
if int(string[i-1]) == num:
pref.append(pref[i - 1] + 1)
else:
pref.append(pref[i - 1])
return pref
n = int(input())
str1 = input()
res1 = prefix(str1)
res2 = prefix(st... | 0 | |
675 | B | Restoring Painting | PROGRAMMING | 1,400 | [
"brute force",
"constructive algorithms",
"math"
] | null | null | Vasya works as a watchman in the gallery. Unfortunately, one of the most expensive paintings was stolen while he was on duty. He doesn't want to be fired, so he has to quickly restore the painting. He remembers some facts about it.
- The painting is a square 3<=×<=3, each cell contains a single integer from 1 to *n*,... | The first line of the input contains five integers *n*, *a*, *b*, *c* and *d* (1<=≤<=*n*<=≤<=100<=000, 1<=≤<=*a*,<=*b*,<=*c*,<=*d*<=≤<=*n*) — maximum possible value of an integer in the cell and four integers that Vasya remembers. | Print one integer — the number of distinct valid squares. | [
"2 1 1 1 2\n",
"3 3 1 2 3\n"
] | [
"2\n",
"6\n"
] | Below are all the possible paintings for the first sample. <img class="tex-graphics" src="https://espresso.codeforces.com/c4c53d4e7b6814d8aad7b72604b6089d61dadb48.png" style="max-width: 100.0%;max-height: 100.0%;"/> <img class="tex-graphics" src="https://espresso.codeforces.com/46a6ad6a5d3db202f3779b045b9dc77fc2348cf1.... | 1,000 | [
{
"input": "2 1 1 1 2",
"output": "2"
},
{
"input": "3 3 1 2 3",
"output": "6"
},
{
"input": "1 1 1 1 1",
"output": "1"
},
{
"input": "1000 522 575 426 445",
"output": "774000"
},
{
"input": "99000 52853 14347 64237 88869",
"output": "1296306000"
},
{
... | 1,570,560,946 | 5,146 | Python 3 | OK | TESTS | 58 | 296 | 0 | n, a, b, c, d = map(int, input().split())
ans = 0
for centro in range(1, n+1):
q1 = a + b + centro
q2 = a + c + centro
q3 = b + d + centro
q4 = c + d + centro
v = [q1, q2, q3, q4]
v.sort()
q_min = v[0]
q_max = v[-1]
if q_min + n < q_max + 1:
continue
elif q_min + n == q_max + 1:
ans += 1
else:
ans += ... | Title: Restoring Painting
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya works as a watchman in the gallery. Unfortunately, one of the most expensive paintings was stolen while he was on duty. He doesn't want to be fired, so he has to quickly restore the painting. He remembers some ... | ```python
n, a, b, c, d = map(int, input().split())
ans = 0
for centro in range(1, n+1):
q1 = a + b + centro
q2 = a + c + centro
q3 = b + d + centro
q4 = c + d + centro
v = [q1, q2, q3, q4]
v.sort()
q_min = v[0]
q_max = v[-1]
if q_min + n < q_max + 1:
continue
elif q_min + n == q_max + 1:
ans += 1
else:... | 3 | |
514 | A | Chewbaсca and Number | PROGRAMMING | 1,200 | [
"greedy",
"implementation"
] | null | null | Luke Skywalker gave Chewbacca an integer number *x*. Chewbacca isn't good at numbers but he loves inverting digits in them. Inverting digit *t* means replacing it with digit 9<=-<=*t*.
Help Chewbacca to transform the initial number *x* to the minimum possible positive number by inverting some (possibly, zero) digits.... | The first line contains a single integer *x* (1<=≤<=*x*<=≤<=1018) — the number that Luke Skywalker gave to Chewbacca. | Print the minimum possible positive number that Chewbacca can obtain after inverting some digits. The number shouldn't contain leading zeroes. | [
"27\n",
"4545\n"
] | [
"22\n",
"4444\n"
] | none | 500 | [
{
"input": "27",
"output": "22"
},
{
"input": "4545",
"output": "4444"
},
{
"input": "1",
"output": "1"
},
{
"input": "9",
"output": "9"
},
{
"input": "8772",
"output": "1222"
},
{
"input": "81",
"output": "11"
},
{
"input": "71723447",
... | 1,690,623,841 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 38 | 46 | 0 | def m(c):
if c in "56789":
return str(9 - int(c))
return c
a = list(input())
s = 0
for i in range(len(a)):
if s == 0:
if a[i] == '9':
continue
s = 1
a[i] = m(a[i])
else:
a[i] = m(a[i])
if a == ['0']:
print(9)
else:
print(""... | Title: Chewbaсca and Number
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Luke Skywalker gave Chewbacca an integer number *x*. Chewbacca isn't good at numbers but he loves inverting digits in them. Inverting digit *t* means replacing it with digit 9<=-<=*t*.
Help Chewbacca to transform... | ```python
def m(c):
if c in "56789":
return str(9 - int(c))
return c
a = list(input())
s = 0
for i in range(len(a)):
if s == 0:
if a[i] == '9':
continue
s = 1
a[i] = m(a[i])
else:
a[i] = m(a[i])
if a == ['0']:
print(9)
else:
... | 0 | |
270 | A | Fancy Fence | PROGRAMMING | 1,100 | [
"geometry",
"implementation",
"math"
] | null | null | Emuskald needs a fence around his farm, but he is too lazy to build it himself. So he purchased a fence-building robot.
He wants the fence to be a regular polygon. The robot builds the fence along a single path, but it can only make fence corners at a single angle *a*.
Will the robot be able to build the fence Emuska... | The first line of input contains an integer *t* (0<=<<=*t*<=<<=180) — the number of tests. Each of the following *t* lines contains a single integer *a* (0<=<<=*a*<=<<=180) — the angle the robot can make corners at measured in degrees. | For each test, output on a single line "YES" (without quotes), if the robot can build a fence Emuskald wants, and "NO" (without quotes), if it is impossible. | [
"3\n30\n60\n90\n"
] | [
"NO\nYES\nYES\n"
] | In the first test case, it is impossible to build the fence, since there is no regular polygon with angle <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/df5f4b07dd5316fde165b43657b2696e2919e791.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
In the second test case, the fence is a r... | 500 | [
{
"input": "3\n30\n60\n90",
"output": "NO\nYES\nYES"
},
{
"input": "6\n1\n2\n3\n170\n179\n25",
"output": "NO\nNO\nNO\nYES\nYES\nNO"
}
] | 1,632,871,963 | 2,147,483,647 | Python 3 | COMPILATION_ERROR | TESTS | 0 | 0 | 0 | n=int(input))
for j in range(n):
k=int(input())
if k<60 :
print('NO')
elif 360%(180-k)==o:
print('YES')
else:
print('NO')
| Title: Fancy Fence
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Emuskald needs a fence around his farm, but he is too lazy to build it himself. So he purchased a fence-building robot.
He wants the fence to be a regular polygon. The robot builds the fence along a single path, but it can... | ```python
n=int(input))
for j in range(n):
k=int(input())
if k<60 :
print('NO')
elif 360%(180-k)==o:
print('YES')
else:
print('NO')
``` | -1 | |
2 | A | Winner | PROGRAMMING | 1,500 | [
"hashing",
"implementation"
] | A. Winner | 1 | 64 | The winner of the card game popular in Berland "Berlogging" is determined according to the following rules. If at the end of the game there is only one player with the maximum number of points, he is the winner. The situation becomes more difficult if the number of such players is more than one. During each round a pla... | The first line contains an integer number *n* (1<=<=≤<=<=*n*<=<=≤<=<=1000), *n* is the number of rounds played. Then follow *n* lines, containing the information about the rounds in "name score" format in chronological order, where name is a string of lower-case Latin letters with the length from 1 to 32, and score is ... | Print the name of the winner. | [
"3\nmike 3\nandrew 5\nmike 2\n",
"3\nandrew 3\nandrew 2\nmike 5\n"
] | [
"andrew\n",
"andrew\n"
] | none | 0 | [
{
"input": "3\nmike 3\nandrew 5\nmike 2",
"output": "andrew"
},
{
"input": "3\nandrew 3\nandrew 2\nmike 5",
"output": "andrew"
},
{
"input": "5\nkaxqybeultn -352\nmgochgrmeyieyskhuourfg -910\nkaxqybeultn 691\nmgochgrmeyieyskhuourfg -76\nkaxqybeultn -303",
"output": "kaxqybeultn"
},... | 1,463,460,339 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 92 | 4,505,600 | n = int(input())
d = {}
for i in range(n):
ins = input().split(" ")
iname = ins[0]
iscore = int(ins[1])
xt = d.get(iname)
if xt != None:
iscore += xt[0]
d.update({iname: (iscore, i)})
w = ["", (0, 0)]
for t in d.items():
if t[1][0] > w[1][0] or (t[1][0] == w[1][0] and... | Title: Winner
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
The winner of the card game popular in Berland "Berlogging" is determined according to the following rules. If at the end of the game there is only one player with the maximum number of points, he is the winner. The situation becomes... | ```python
n = int(input())
d = {}
for i in range(n):
ins = input().split(" ")
iname = ins[0]
iscore = int(ins[1])
xt = d.get(iname)
if xt != None:
iscore += xt[0]
d.update({iname: (iscore, i)})
w = ["", (0, 0)]
for t in d.items():
if t[1][0] > w[1][0] or (t[1][0] == w... | 0 |
837 | G | Functions On The Segments | PROGRAMMING | 2,500 | [
"data structures"
] | null | null | You have an array *f* of *n* functions.The function *f**i*(*x*) (1<=≤<=*i*<=≤<=*n*) is characterized by parameters: *x*1,<=*x*2,<=*y*1,<=*a*,<=*b*,<=*y*2 and take values:
- *y*1, if *x*<=≤<=*x*1. - *a*·*x*<=+<=*b*, if *x*1<=<<=*x*<=≤<=*x*2. - *y*2, if *x*<=><=*x*2.
There are *m* queries. Each query is deter... | First line contains one integer number *n* (1<=≤<=*n*<=≤<=75000).
Each of the next *n* lines contains six integer numbers: *x*1,<=*x*2,<=*y*1,<=*a*,<=*b*,<=*y*2 (0<=≤<=*x*1<=<<=*x*2<=≤<=2·105, 0<=≤<=*y*1,<=*y*2<=≤<=109, 0<=≤<=*a*,<=*b*<=≤<=104).
Next line contains one integer number *m* (1<=≤<=*m*<=≤<=500000).
Ea... | none | [
"1\n1 2 1 4 5 10\n1\n1 1 2\n",
"3\n2 5 1 1 1 4\n3 6 8 2 5 7\n1 3 5 1 4 10\n3\n1 3 3\n2 3 2\n1 2 5\n"
] | [
"13\n",
"19\n17\n11\n"
] | none | 0 | [
{
"input": "1\n1 2 1 4 5 10\n1\n1 1 2",
"output": "13"
},
{
"input": "3\n2 5 1 1 1 4\n3 6 8 2 5 7\n1 3 5 1 4 10\n3\n1 3 3\n2 3 2\n1 2 5",
"output": "19\n17\n11"
},
{
"input": "7\n4 8 562244866 6 8 140807945\n5 7 415374420 7 6 596093578\n3 4 766370993 3 7 973128805\n4 6 841321398 3 2 8931... | 1,690,495,159 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 0 | 46 | 0 | print("_RANDOM_GUESS_1690495159.3495986")# 1690495159.3496218 | Title: Functions On The Segments
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You have an array *f* of *n* functions.The function *f**i*(*x*) (1<=≤<=*i*<=≤<=*n*) is characterized by parameters: *x*1,<=*x*2,<=*y*1,<=*a*,<=*b*,<=*y*2 and take values:
- *y*1, if *x*<=≤<=*x*1. - *a*·*x*... | ```python
print("_RANDOM_GUESS_1690495159.3495986")# 1690495159.3496218
``` | 0 | |
776 | B | Sherlock and his girlfriend | PROGRAMMING | 1,200 | [
"constructive algorithms",
"number theory"
] | null | null | Sherlock has a new girlfriend (so unlike him!). Valentine's day is coming and he wants to gift her some jewelry.
He bought *n* pieces of jewelry. The *i*-th piece has price equal to *i*<=+<=1, that is, the prices of the jewelry are 2,<=3,<=4,<=... *n*<=+<=1.
Watson gave Sherlock a challenge to color these jewelry pie... | The only line contains single integer *n* (1<=≤<=*n*<=≤<=100000) — the number of jewelry pieces. | The first line of output should contain a single integer *k*, the minimum number of colors that can be used to color the pieces of jewelry with the given constraints.
The next line should consist of *n* space-separated integers (between 1 and *k*) that specify the color of each piece in the order of increasing price.
... | [
"3\n",
"4\n"
] | [
"2\n1 1 2 ",
"2\n2 1 1 2\n"
] | In the first input, the colors for first, second and third pieces of jewelry having respective prices 2, 3 and 4 are 1, 1 and 2 respectively.
In this case, as 2 is a prime divisor of 4, colors of jewelry having prices 2 and 4 must be distinct. | 1,000 | [
{
"input": "3",
"output": "2\n1 1 2 "
},
{
"input": "4",
"output": "2\n1 1 2 1 "
},
{
"input": "17",
"output": "2\n1 1 2 1 2 1 2 2 2 1 2 1 2 2 2 1 2 "
},
{
"input": "25",
"output": "2\n1 1 2 1 2 1 2 2 2 1 2 1 2 2 2 1 2 1 2 2 2 1 2 2 2 "
},
{
"input": "85",
"ou... | 1,649,050,264 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 3 | 77 | 0 | #sieve of Eratosthenes
x=int(input())
mo=x+10
prime=[True for i in range(mo)]
prime[0]=False
prime[1]=False
# sieve only till root of n
for i in range(0,int((mo)**0.5),1):
if prime[i]:
for j in range(i*i,mo,i):
prime[j]=False
#print(*prime)
primes=[]
if x>2:
print(2)
else:
... | Title: Sherlock and his girlfriend
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Sherlock has a new girlfriend (so unlike him!). Valentine's day is coming and he wants to gift her some jewelry.
He bought *n* pieces of jewelry. The *i*-th piece has price equal to *i*<=+<=1, that is, the ... | ```python
#sieve of Eratosthenes
x=int(input())
mo=x+10
prime=[True for i in range(mo)]
prime[0]=False
prime[1]=False
# sieve only till root of n
for i in range(0,int((mo)**0.5),1):
if prime[i]:
for j in range(i*i,mo,i):
prime[j]=False
#print(*prime)
primes=[]
if x>2:
print(2... | 0 | |
217 | A | Ice Skating | PROGRAMMING | 1,200 | [
"brute force",
"dfs and similar",
"dsu",
"graphs"
] | null | null | Bajtek is learning to skate on ice. He's a beginner, so his only mode of transportation is pushing off from a snow drift to the north, east, south or west and sliding until he lands in another snow drift. He has noticed that in this way it's impossible to get from some snow drifts to some other by any sequence of moves... | The first line of input contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of snow drifts. Each of the following *n* lines contains two integers *x**i* and *y**i* (1<=≤<=*x**i*,<=*y**i*<=≤<=1000) — the coordinates of the *i*-th snow drift.
Note that the north direction coinсides with the direction of *Oy* ... | Output the minimal number of snow drifts that need to be created in order for Bajtek to be able to reach any snow drift from any other one. | [
"2\n2 1\n1 2\n",
"2\n2 1\n4 1\n"
] | [
"1\n",
"0\n"
] | none | 500 | [
{
"input": "2\n2 1\n1 2",
"output": "1"
},
{
"input": "2\n2 1\n4 1",
"output": "0"
},
{
"input": "24\n171 35\n261 20\n4 206\n501 446\n961 912\n581 748\n946 978\n463 514\n841 889\n341 466\n842 967\n54 102\n235 261\n925 889\n682 672\n623 636\n268 94\n635 710\n474 510\n697 794\n586 663\n182... | 1,670,291,882 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 60 | 512,000 | def calculate(elem):
if rank[elem] < 0:
rank[elem] = elem
if x != rank[elem]:
rank[elem]= calculate(rank[elem])
return rank[elem]
n = int(input())
rank = [-1] * 9999
for _ in range(n):
x, y = map(int, input().split())
y += 1000
n -= (rank[y] >= 0) + (rank[x] >= 0) - (calculate(y) == calculate(x))
... | Title: Ice Skating
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bajtek is learning to skate on ice. He's a beginner, so his only mode of transportation is pushing off from a snow drift to the north, east, south or west and sliding until he lands in another snow drift. He has noticed tha... | ```python
def calculate(elem):
if rank[elem] < 0:
rank[elem] = elem
if x != rank[elem]:
rank[elem]= calculate(rank[elem])
return rank[elem]
n = int(input())
rank = [-1] * 9999
for _ in range(n):
x, y = map(int, input().split())
y += 1000
n -= (rank[y] >= 0) + (rank[x] >= 0) - (calculate(y) == calc... | -1 | |
920 | A | Water The Garden | PROGRAMMING | 1,000 | [
"implementation"
] | null | null | It is winter now, and Max decided it's about time he watered the garden.
The garden can be represented as *n* consecutive garden beds, numbered from 1 to *n*. *k* beds contain water taps (*i*-th tap is located in the bed *x**i*), which, if turned on, start delivering water to neighbouring beds. If the tap on the bed *... | The first line contains one integer *t* — the number of test cases to solve (1<=≤<=*t*<=≤<=200).
Then *t* test cases follow. The first line of each test case contains two integers *n* and *k* (1<=≤<=*n*<=≤<=200, 1<=≤<=*k*<=≤<=*n*) — the number of garden beds and water taps, respectively.
Next line contains *k* intege... | For each test case print one integer — the minimum number of seconds that have to pass after Max turns on some of the water taps, until the whole garden is watered. | [
"3\n5 1\n3\n3 3\n1 2 3\n4 1\n1\n"
] | [
"3\n1\n4\n"
] | The first example consists of 3 tests:
1. There are 5 garden beds, and a water tap in the bed 3. If we turn it on, then after 1 second passes, only bed 3 will be watered; after 2 seconds pass, beds [1, 3] will be watered, and after 3 seconds pass, everything will be watered. 1. There are 3 garden beds, and there is ... | 0 | [
{
"input": "3\n5 1\n3\n3 3\n1 2 3\n4 1\n1",
"output": "3\n1\n4"
},
{
"input": "26\n1 1\n1\n2 1\n2\n2 1\n1\n2 2\n1 2\n3 1\n3\n3 1\n2\n3 2\n2 3\n3 1\n1\n3 2\n1 3\n3 2\n1 2\n3 3\n1 2 3\n4 1\n4\n4 1\n3\n4 2\n3 4\n4 1\n2\n4 2\n2 4\n4 2\n2 3\n4 3\n2 3 4\n4 1\n1\n4 2\n1 4\n4 2\n1 3\n4 3\n1 3 4\n4 2\n1 2\n4... | 1,606,739,971 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 108 | 307,200 | for z in range(int(input())):
a, b = list(map(int, input().split()))
c = sorted(list(map(int, input().split())))
e = c[0]
f = 0
for i in range(1, len(c)):
f = max(e, -(-(c[i] - c[i - 1]) // 2))
e = -(-(c[i] - c[i - 1]) // 2)
print(a - c[-1] + 1, f)
print(max(a - c[-1... | Title: Water The Garden
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
It is winter now, and Max decided it's about time he watered the garden.
The garden can be represented as *n* consecutive garden beds, numbered from 1 to *n*. *k* beds contain water taps (*i*-th tap is located in the ... | ```python
for z in range(int(input())):
a, b = list(map(int, input().split()))
c = sorted(list(map(int, input().split())))
e = c[0]
f = 0
for i in range(1, len(c)):
f = max(e, -(-(c[i] - c[i - 1]) // 2))
e = -(-(c[i] - c[i - 1]) // 2)
print(a - c[-1] + 1, f)
print(ma... | 0 | |
721 | A | One-dimensional Japanese Crossword | PROGRAMMING | 800 | [
"implementation"
] | null | null | Recently Adaltik discovered japanese crosswords. Japanese crossword is a picture, represented as a table sized *a*<=×<=*b* squares, and each square is colored white or black. There are integers to the left of the rows and to the top of the columns, encrypting the corresponding row or column. The number of integers repr... | The first line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the length of the row. The second line of the input contains a single string consisting of *n* characters 'B' or 'W', ('B' corresponds to black square, 'W' — to white square in the row that Adaltik drew). | The first line should contain a single integer *k* — the number of integers encrypting the row, e.g. the number of groups of black squares in the row.
The second line should contain *k* integers, encrypting the row, e.g. corresponding to sizes of groups of consecutive black squares in the order from left to right. | [
"3\nBBW\n",
"5\nBWBWB\n",
"4\nWWWW\n",
"4\nBBBB\n",
"13\nWBBBBWWBWBBBW\n"
] | [
"1\n2 ",
"3\n1 1 1 ",
"0\n",
"1\n4 ",
"3\n4 1 3 "
] | The last sample case correspond to the picture in the statement. | 500 | [
{
"input": "3\nBBW",
"output": "1\n2 "
},
{
"input": "5\nBWBWB",
"output": "3\n1 1 1 "
},
{
"input": "4\nWWWW",
"output": "0"
},
{
"input": "4\nBBBB",
"output": "1\n4 "
},
{
"input": "13\nWBBBBWWBWBBBW",
"output": "3\n4 1 3 "
},
{
"input": "1\nB",
... | 1,633,962,872 | 2,147,483,647 | PyPy 3 | OK | TESTS | 54 | 93 | 20,172,800 | if __name__ == "__main__":
n = int(input())
string = input()
res, total = [], 0
count = 0
for s in string:
if s == "B":
count += 1
else:
if count != 0:
total += 1
res.append(str(count))
count = 0
... | Title: One-dimensional Japanese Crossword
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Recently Adaltik discovered japanese crosswords. Japanese crossword is a picture, represented as a table sized *a*<=×<=*b* squares, and each square is colored white or black. There are integers to the... | ```python
if __name__ == "__main__":
n = int(input())
string = input()
res, total = [], 0
count = 0
for s in string:
if s == "B":
count += 1
else:
if count != 0:
total += 1
res.append(str(count))
coun... | 3 | |
461 | A | Appleman and Toastman | PROGRAMMING | 1,200 | [
"greedy",
"sortings"
] | null | null | Appleman and Toastman play a game. Initially Appleman gives one group of *n* numbers to the Toastman, then they start to complete the following tasks:
- Each time Toastman gets a group of numbers, he sums up all the numbers and adds this sum to the score. Then he gives the group to the Appleman. - Each time Appleman... | The first line contains a single integer *n* (1<=≤<=*n*<=≤<=3·105). The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=106) — the initial group that is given to Toastman. | Print a single integer — the largest possible score. | [
"3\n3 1 5\n",
"1\n10\n"
] | [
"26\n",
"10\n"
] | Consider the following situation in the first example. Initially Toastman gets group [3, 1, 5] and adds 9 to the score, then he give the group to Appleman. Appleman splits group [3, 1, 5] into two groups: [3, 5] and [1]. Both of them should be given to Toastman. When Toastman receives group [1], he adds 1 to score and ... | 500 | [
{
"input": "3\n3 1 5",
"output": "26"
},
{
"input": "1\n10",
"output": "10"
},
{
"input": "10\n8 10 2 5 6 2 4 7 2 1",
"output": "376"
},
{
"input": "10\n171308 397870 724672 431255 228496 892002 542924 718337 888642 161821",
"output": "40204082"
},
{
"input": "10\... | 1,449,766,691 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 6 | 2,000 | 5,734,400 | n=int(input())
a=[int(i) for i in input().split()]
he=sum(a)
b=0
while b<n-1:
a.sort()
he=he+sum(a)
del a[0]
b=b+1
print(he) | Title: Appleman and Toastman
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Appleman and Toastman play a game. Initially Appleman gives one group of *n* numbers to the Toastman, then they start to complete the following tasks:
- Each time Toastman gets a group of numbers, he sums up all... | ```python
n=int(input())
a=[int(i) for i in input().split()]
he=sum(a)
b=0
while b<n-1:
a.sort()
he=he+sum(a)
del a[0]
b=b+1
print(he)
``` | 0 | |
931 | B | World Cup | PROGRAMMING | 1,200 | [
"constructive algorithms",
"implementation"
] | null | null | The last stage of Football World Cup is played using the play-off system.
There are *n* teams left in this stage, they are enumerated from 1 to *n*. Several rounds are held, in each round the remaining teams are sorted in the order of their ids, then the first in this order plays with the second, the third — with the ... | The only line contains three integers *n*, *a* and *b* (2<=≤<=*n*<=≤<=256, 1<=≤<=*a*,<=*b*<=≤<=*n*) — the total number of teams, and the ids of the teams that Arkady is interested in.
It is guaranteed that *n* is such that in each round an even number of team advance, and that *a* and *b* are not equal. | In the only line print "Final!" (without quotes), if teams *a* and *b* can meet in the Final.
Otherwise, print a single integer — the number of the round in which teams *a* and *b* can meet. The round are enumerated from 1. | [
"4 1 2\n",
"8 2 6\n",
"8 7 5\n"
] | [
"1\n",
"Final!\n",
"2\n"
] | In the first example teams 1 and 2 meet in the first round.
In the second example teams 2 and 6 can only meet in the third round, which is the Final, if they win all their opponents in earlier rounds.
In the third example the teams with ids 7 and 5 can meet in the second round, if they win their opponents in the firs... | 1,000 | [
{
"input": "4 1 2",
"output": "1"
},
{
"input": "8 2 6",
"output": "Final!"
},
{
"input": "8 7 5",
"output": "2"
},
{
"input": "128 30 98",
"output": "Final!"
},
{
"input": "256 128 256",
"output": "Final!"
},
{
"input": "256 2 127",
"output": "7"
... | 1,520,179,288 | 1,588 | Python 3 | OK | TESTS | 64 | 77 | 5,632,000 | arr = input().split(' ')
n = int(arr[0])
a = int(arr[1])
b = int(arr[2])
a -= 1
b -= 1
ra = a//2
rb = b//2
c = 1
while ra!=rb:
ra = ra//2
rb = rb//2
c += 1
if(pow(2,c)==n): print("Final!")
else: print(c) | Title: World Cup
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The last stage of Football World Cup is played using the play-off system.
There are *n* teams left in this stage, they are enumerated from 1 to *n*. Several rounds are held, in each round the remaining teams are sorted in th... | ```python
arr = input().split(' ')
n = int(arr[0])
a = int(arr[1])
b = int(arr[2])
a -= 1
b -= 1
ra = a//2
rb = b//2
c = 1
while ra!=rb:
ra = ra//2
rb = rb//2
c += 1
if(pow(2,c)==n): print("Final!")
else: print(c)
``` | 3 | |
158 | A | Next Round | PROGRAMMING | 800 | [
"*special",
"implementation"
] | null | null | "Contestant who earns a score equal to or greater than the *k*-th place finisher's score will advance to the next round, as long as the contestant earns a positive score..." — an excerpt from contest rules.
A total of *n* participants took part in the contest (*n*<=≥<=*k*), and you already know their scores. Calculate... | The first line of the input contains two integers *n* and *k* (1<=≤<=*k*<=≤<=*n*<=≤<=50) separated by a single space.
The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=100), where *a**i* is the score earned by the participant who got the *i*-th place. The given sequence... | Output the number of participants who advance to the next round. | [
"8 5\n10 9 8 7 7 7 5 5\n",
"4 2\n0 0 0 0\n"
] | [
"6\n",
"0\n"
] | In the first example the participant on the 5th place earned 7 points. As the participant on the 6th place also earned 7 points, there are 6 advancers.
In the second example nobody got a positive score. | 500 | [
{
"input": "8 5\n10 9 8 7 7 7 5 5",
"output": "6"
},
{
"input": "4 2\n0 0 0 0",
"output": "0"
},
{
"input": "5 1\n1 1 1 1 1",
"output": "5"
},
{
"input": "5 5\n1 1 1 1 1",
"output": "5"
},
{
"input": "1 1\n10",
"output": "1"
},
{
"input": "17 14\n16 15... | 1,698,826,858 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 30 | 0 | # Read the input integer
n = int(input())
# Get the first digit by converting the absolute value of the number to a string
first_digit = int(str(abs(n))[0])
# If the original number is negative, make the first digit negative as well
if n < 0:
first_digit = -first_digit
# Print the first digit
print(first_digit)
... | Title: Next Round
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
"Contestant who earns a score equal to or greater than the *k*-th place finisher's score will advance to the next round, as long as the contestant earns a positive score..." — an excerpt from contest rules.
A total of *n* p... | ```python
# Read the input integer
n = int(input())
# Get the first digit by converting the absolute value of the number to a string
first_digit = int(str(abs(n))[0])
# If the original number is negative, make the first digit negative as well
if n < 0:
first_digit = -first_digit
# Print the first digit
print(fir... | -1 | |
69 | A | Young Physicist | PROGRAMMING | 1,000 | [
"implementation",
"math"
] | A. Young Physicist | 2 | 256 | A guy named Vasya attends the final grade of a high school. One day Vasya decided to watch a match of his favorite hockey team. And, as the boy loves hockey very much, even more than physics, he forgot to do the homework. Specifically, he forgot to complete his physics tasks. Next day the teacher got very angry at Vasy... | The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100), then follow *n* lines containing three integers each: the *x**i* coordinate, the *y**i* coordinate and the *z**i* coordinate of the force vector, applied to the body (<=-<=100<=≤<=*x**i*,<=*y**i*,<=*z**i*<=≤<=100). | Print the word "YES" if the body is in equilibrium, or the word "NO" if it is not. | [
"3\n4 1 7\n-2 4 -1\n1 -5 -3\n",
"3\n3 -1 7\n-5 2 -4\n2 -1 -3\n"
] | [
"NO",
"YES"
] | none | 500 | [
{
"input": "3\n4 1 7\n-2 4 -1\n1 -5 -3",
"output": "NO"
},
{
"input": "3\n3 -1 7\n-5 2 -4\n2 -1 -3",
"output": "YES"
},
{
"input": "10\n21 32 -46\n43 -35 21\n42 2 -50\n22 40 20\n-27 -9 38\n-4 1 1\n-40 6 -31\n-13 -2 34\n-21 34 -12\n-32 -29 41",
"output": "NO"
},
{
"input": "10... | 1,528,311,496 | 2,147,483,647 | Python 3 | OK | TESTS | 81 | 186 | 0 | n = int(input())
x = y = z = 0
for k in range(n):
m = list(map(int, input().split()))
x += m[0]
y += m[1]
z += m[2]
if x == y == z == 0:
print('YES')
else:
print('NO')
| Title: Young Physicist
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
A guy named Vasya attends the final grade of a high school. One day Vasya decided to watch a match of his favorite hockey team. And, as the boy loves hockey very much, even more than physics, he forgot to do the homework. S... | ```python
n = int(input())
x = y = z = 0
for k in range(n):
m = list(map(int, input().split()))
x += m[0]
y += m[1]
z += m[2]
if x == y == z == 0:
print('YES')
else:
print('NO')
``` | 3.9535 |
234 | A | Lefthanders and Righthanders | PROGRAMMING | 1,200 | [
"implementation"
] | null | null | One fine October day a mathematics teacher Vasily Petrov went to a class and saw there *n* pupils who sat at the desks, two people at each desk. Vasily quickly realized that number *n* is even. Like all true mathematicians, Vasily has all students numbered from 1 to *n*.
But Vasily Petrov did not like the way the chi... | The first input line contains a single even integer *n* (4<=≤<=*n*<=≤<=100) — the number of students in the class. The second line contains exactly *n* capital English letters "L" and "R". If the *i*-th letter at the second line equals "L", then the student number *i* is a lefthander, otherwise he is a righthander. | Print integer pairs, one pair per line. In the *i*-th line print the numbers of students that will sit at the *i*-th desk. The first number in the pair stands for the student who is sitting to the left, and the second number stands for the student who is sitting to the right. Separate the numbers in the pairs by space... | [
"6\nLLRLLL\n",
"4\nRRLL\n"
] | [
"1 4\n2 5\n6 3\n",
"3 1\n4 2\n"
] | none | 0 | [
{
"input": "6\nLLRLLL",
"output": "1 4\n2 5\n6 3"
},
{
"input": "4\nRRLL",
"output": "3 1\n4 2"
},
{
"input": "4\nLLRR",
"output": "1 3\n2 4"
},
{
"input": "6\nRLLRRL",
"output": "1 4\n2 5\n3 6"
},
{
"input": "8\nLRLRLLLR",
"output": "1 5\n6 2\n3 7\n4 8"
},
... | 1,681,049,916 | 2,147,483,647 | PyPy 3-64 | RUNTIME_ERROR | TESTS | 0 | 77 | 2,764,800 | from sys import stdin
def input(): return stdin.readline()[:-1]
n=int(input())
s=list(input())
l=[]
r=[]
for i in range(len(s)):
if s[i]=="L":
l.append(i+1)
else:
r.append(i+1)
ans=[]
ll=len(l)
lr=len(r)
for i in range(0,min(ll,lr)):
ans.append([l[i],r[i]])
curr=i+1
if ll>=lr:
for j in range(... | Title: Lefthanders and Righthanders
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One fine October day a mathematics teacher Vasily Petrov went to a class and saw there *n* pupils who sat at the desks, two people at each desk. Vasily quickly realized that number *n* is even. Like all t... | ```python
from sys import stdin
def input(): return stdin.readline()[:-1]
n=int(input())
s=list(input())
l=[]
r=[]
for i in range(len(s)):
if s[i]=="L":
l.append(i+1)
else:
r.append(i+1)
ans=[]
ll=len(l)
lr=len(r)
for i in range(0,min(ll,lr)):
ans.append([l[i],r[i]])
curr=i+1
if ll>=lr:
for j... | -1 | |
625 | A | Guest From the Past | PROGRAMMING | 1,700 | [
"implementation",
"math"
] | null | null | Kolya Gerasimov loves kefir very much. He lives in year 1984 and knows all the details of buying this delicious drink. One day, as you probably know, he found himself in year 2084, and buying kefir there is much more complicated.
Kolya is hungry, so he went to the nearest milk shop. In 2084 you may buy kefir in a plas... | First line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=1018) — the number of rubles Kolya has at the beginning.
Then follow three lines containing integers *a*, *b* and *c* (1<=≤<=*a*<=≤<=1018, 1<=≤<=*c*<=<<=*b*<=≤<=1018) — the cost of one plastic liter bottle, the cost of one glass liter bottle and t... | Print the only integer — maximum number of liters of kefir, that Kolya can drink. | [
"10\n11\n9\n8\n",
"10\n5\n6\n1\n"
] | [
"2\n",
"2\n"
] | In the first sample, Kolya can buy one glass bottle, then return it and buy one more glass bottle. Thus he will drink 2 liters of kefir.
In the second sample, Kolya can buy two plastic bottle and get two liters of kefir, or he can buy one liter glass bottle, then return it and buy one plastic bottle. In both cases he ... | 750 | [
{
"input": "10\n11\n9\n8",
"output": "2"
},
{
"input": "10\n5\n6\n1",
"output": "2"
},
{
"input": "2\n2\n2\n1",
"output": "1"
},
{
"input": "10\n3\n3\n1",
"output": "4"
},
{
"input": "10\n1\n2\n1",
"output": "10"
},
{
"input": "10\n2\n3\n1",
"outpu... | 1,455,116,087 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 6 | 46 | 0 | n, a, b, c = [int(input()) for i in range(4)]
res = (n - c) // (b - c)
n -= res * (b - c)
res += n // a
print(res) | Title: Guest From the Past
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Kolya Gerasimov loves kefir very much. He lives in year 1984 and knows all the details of buying this delicious drink. One day, as you probably know, he found himself in year 2084, and buying kefir there is much mor... | ```python
n, a, b, c = [int(input()) for i in range(4)]
res = (n - c) // (b - c)
n -= res * (b - c)
res += n // a
print(res)
``` | 0 | |
879 | B | Table Tennis | PROGRAMMING | 1,200 | [
"data structures",
"implementation"
] | null | null | *n* people are standing in a line to play table tennis. At first, the first two players in the line play a game. Then the loser goes to the end of the line, and the winner plays with the next person from the line, and so on. They play until someone wins *k* games in a row. This player becomes the winner.
For each of t... | The first line contains two integers: *n* and *k* (2<=≤<=*n*<=≤<=500, 2<=≤<=*k*<=≤<=1012) — the number of people and the number of wins.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=*n*) — powers of the player. It's guaranteed that this line contains a valid permutation, i.e. all ... | Output a single integer — power of the winner. | [
"2 2\n1 2\n",
"4 2\n3 1 2 4\n",
"6 2\n6 5 3 1 2 4\n",
"2 10000000000\n2 1\n"
] | [
"2 ",
"3 ",
"6 ",
"2\n"
] | Games in the second sample:
3 plays with 1. 3 wins. 1 goes to the end of the line.
3 plays with 2. 3 wins. He wins twice in a row. He becomes the winner. | 1,000 | [
{
"input": "2 2\n1 2",
"output": "2 "
},
{
"input": "4 2\n3 1 2 4",
"output": "3 "
},
{
"input": "6 2\n6 5 3 1 2 4",
"output": "6 "
},
{
"input": "2 10000000000\n2 1",
"output": "2"
},
{
"input": "4 4\n1 3 4 2",
"output": "4 "
},
{
"input": "2 21474836... | 1,572,853,413 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 32 | 155 | 0 | nk = input().split()
n = int(nk[0])
k = int(nk[1])
players = [int(i) for i in input().split()]
if k>n:
print(max(players))
else:
playing = players[0:2]
queue = players[2:]
win = False
wins = 0
while wins<k:
if playing[0]>playing[1]:
wins+=1
queue.app... | Title: Table Tennis
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
*n* people are standing in a line to play table tennis. At first, the first two players in the line play a game. Then the loser goes to the end of the line, and the winner plays with the next person from the line, and so o... | ```python
nk = input().split()
n = int(nk[0])
k = int(nk[1])
players = [int(i) for i in input().split()]
if k>n:
print(max(players))
else:
playing = players[0:2]
queue = players[2:]
win = False
wins = 0
while wins<k:
if playing[0]>playing[1]:
wins+=1
... | 0 | |
61 | A | Ultra-Fast Mathematician | PROGRAMMING | 800 | [
"implementation"
] | A. Ultra-Fast Mathematician | 2 | 256 | Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second.
One day in 230 AD Shapur was trying to find out if any one can possibly do... | There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100. | Write one line — the corresponding answer. Do not omit the leading 0s. | [
"1010100\n0100101\n",
"000\n111\n",
"1110\n1010\n",
"01110\n01100\n"
] | [
"1110001\n",
"111\n",
"0100\n",
"00010\n"
] | none | 500 | [
{
"input": "1010100\n0100101",
"output": "1110001"
},
{
"input": "000\n111",
"output": "111"
},
{
"input": "1110\n1010",
"output": "0100"
},
{
"input": "01110\n01100",
"output": "00010"
},
{
"input": "011101\n000001",
"output": "011100"
},
{
"input": "... | 1,586,506,647 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 93 | 0 | x = input()
x1 = input()
s=""
for i in range(len(x)):
if x[i]==x1[i]:
s+='0'
else:
s+='1'
print(int(s)) | Title: Ultra-Fast Mathematician
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 10... | ```python
x = input()
x1 = input()
s=""
for i in range(len(x)):
if x[i]==x1[i]:
s+='0'
else:
s+='1'
print(int(s))
``` | 0 |
748 | A | Santa Claus and a Place in a Class | PROGRAMMING | 800 | [
"implementation",
"math"
] | null | null | Santa Claus is the first who came to the Christmas Olympiad, and he is going to be the first to take his place at a desk! In the classroom there are *n* lanes of *m* desks each, and there are two working places at each of the desks. The lanes are numbered from 1 to *n* from the left to the right, the desks in a lane ar... | The only line contains three integers *n*, *m* and *k* (1<=≤<=*n*,<=*m*<=≤<=10<=000, 1<=≤<=*k*<=≤<=2*nm*) — the number of lanes, the number of desks in each lane and the number of Santa Claus' place. | Print two integers: the number of lane *r*, the number of desk *d*, and a character *s*, which stands for the side of the desk Santa Claus. The character *s* should be "L", if Santa Clause should sit on the left, and "R" if his place is on the right. | [
"4 3 9\n",
"4 3 24\n",
"2 4 4\n"
] | [
"2 2 L\n",
"4 3 R\n",
"1 2 R\n"
] | The first and the second samples are shown on the picture. The green place corresponds to Santa Claus' place in the first example, the blue place corresponds to Santa Claus' place in the second example.
In the third sample there are two lanes with four desks in each, and Santa Claus has the fourth place. Thus, his pla... | 500 | [
{
"input": "4 3 9",
"output": "2 2 L"
},
{
"input": "4 3 24",
"output": "4 3 R"
},
{
"input": "2 4 4",
"output": "1 2 R"
},
{
"input": "3 10 24",
"output": "2 2 R"
},
{
"input": "10 3 59",
"output": "10 3 L"
},
{
"input": "10000 10000 160845880",
"... | 1,482,657,367 | 667 | Python 3 | OK | TESTS | 46 | 77 | 4,608,000 | n,m,k=[int(i) for i in input().split()]
ryad=k//(2*m)+1
if k%(2*m)==0:
ryad-=1
parta=(k-2*m*(ryad-1))//2+k%2
if k%2==0:
mesto='R'
else:
mesto='L'
print(ryad,parta,mesto) | Title: Santa Claus and a Place in a Class
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Santa Claus is the first who came to the Christmas Olympiad, and he is going to be the first to take his place at a desk! In the classroom there are *n* lanes of *m* desks each, and there are two work... | ```python
n,m,k=[int(i) for i in input().split()]
ryad=k//(2*m)+1
if k%(2*m)==0:
ryad-=1
parta=(k-2*m*(ryad-1))//2+k%2
if k%2==0:
mesto='R'
else:
mesto='L'
print(ryad,parta,mesto)
``` | 3 |
Subsets and Splits
Successful Python Submissions
Retrieves all records from the train dataset where the verdict is 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Retrieves records of users with a rating of 1600 or higher and a verdict of 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Counts the number of entries with a rating above 2000 and a verdict of 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Counts the number of entries with a 'OK' verdict, providing a basic overview of a specific category within the dataset.